Words similar to prdap
Example sentences for: prdap
How can you use “prdap” in a sentence? Here are some example sentences to help you improve your vocabulary:
Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
PCR primers (prdap25: cacctccaggatgtgttagc and prdazp26:gtcaccaagggtgtctgaag) were designed from intronic sequences flanking Dazap1 exon 8. These primers amplified a 271 bp fragment from mouse but not hamster genomic DNA.
The 5' end of the cDNA was isolated by 5' RACE [ 15 ] , using prdap11 (ttgcgggccatatccttg, #749-732) as the primer for cDNA synthesis from mouse testis RNA, and prdap37 (ttgttgccacgtgggcg, #734-718) and an adaptor primer as the primers for PCR amplification.
Loading...