Words similar to polyhistidine

Example sentences for: polyhistidine

How can you use “polyhistidine” in a sentence? Here are some example sentences to help you improve your vocabulary:

The cDNAs encoding Rab24(wt) and Rab24(D123I) were subcloned into a pCMV5 vector that had been modified by PCR to encode an in-frame polyhistidine tag (His 6 ) at the amino-terminus of the Rab protein.
An 8x polyhistidine epitope tag was added to the N-terminus of EGFP with an oligonucleotide adapter (5'AAAACTGCAGCGGCCGCCACCATGCACCAC-CACCACACCACCACCACGTGAGCAAGGGCGAGGAGCTGTTCACCG3').