Words similar to plexa
Example sentences for: plexa
How can you use “plexa” in a sentence? Here are some example sentences to help you improve your vocabulary:
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
pVT725 was created by replacing the ampicillin resistance cassette on pLexA (Clontech) with a kanamycin resistance gene (obtained from pGBKT7 (Clontech) by PCR) via homologous recombination in yeast.
Loading...