Words similar to plexa
Example sentences for: plexa
How can you use “plexa” in a sentence? Here are some example sentences to help you improve your vocabulary:
pVT725 was created by replacing the ampicillin resistance cassette on pLexA (Clontech) with a kanamycin resistance gene (obtained from pGBKT7 (Clontech) by PCR) via homologous recombination in yeast.
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
Loading...