Example sentences for: plasmodium

How can you use “plasmodium” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Furthermore, in the study area, people are also subject to other Plasmodium infections i.e.

  • Plasmodium falciparum

  • The second case is exemplified by Plasmodium falciparum where chromosomes II and III are selected to the exclusion of the other 12.

  • The following oligodeoxynucleotide primers were designed against the putative PfPP5 sequence found on chromosome 13 (AL049185; Plasmodium falciparum chr13_002073): ATGTTACACAACCATGATGTAGAAGAAG;TAAATGTTTTGATACAAATTATGAGC.

  • In addition, only one other protein [called rhoptry, from Plasmodium yoelii (accession # T28677)], fell within our 10 -3BLAST search cutoff in two instances (with T13994 and p20829 [Table 1]).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast