Words similar to plasmodium
Example sentences for: plasmodium
How can you use “plasmodium” in a sentence? Here are some example sentences to help you improve your vocabulary:
Furthermore, in the study area, people are also subject to other Plasmodium infections i.e.
Plasmodium falciparum
The second case is exemplified by Plasmodium falciparum where chromosomes II and III are selected to the exclusion of the other 12.
The following oligodeoxynucleotide primers were designed against the putative PfPP5 sequence found on chromosome 13 (AL049185; Plasmodium falciparum chr13_002073): ATGTTACACAACCATGATGTAGAAGAAG;TAAATGTTTTGATACAAATTATGAGC.
In addition, only one other protein [called rhoptry, from Plasmodium yoelii (accession # T28677)], fell within our 10 -3BLAST search cutoff in two instances (with T13994 and p20829 [Table 1]).