Words similar to plasmodium

Example sentences for: plasmodium

How can you use “plasmodium” in a sentence? Here are some example sentences to help you improve your vocabulary:

Plasmodium vivax
Mammalian protein phosphatase 5 (PP5) and its homolog protein phosphatase T1 (Ppt1p) from the yeast Saccharomyces cerevisiae contain a catalytic domain structurally related to the catalytic subunits of PP1, PP2A and PP2B, and an N-terminal domain consisting of multiple tetratricopeptide repeats (TPRs) not found in other members of this family of phosphatases [ 1 2 3 ] . Homologs have also been identified in Xenopus laevis [ 4 ] , Neurospora crassa [ 5 ] , Drosophila melanogaster [ 6 ] , Trypanosoma brucei [ 7 ] , Plasmodium falciparum [ 8 9 ] , and cauliflower [ 10 ] , and homologs for Caenorhabditis elegans, Schizosaccharomyces pombe and Arabidopsis thaliana are predicted (accession number CAB60937, CAA17690 and AAD21727, respectively).
In the recent past, this has led to the identification of a number of Plasmodium protein phosphatases, some putative [ 12 13 ] , others experimentally demonstrated [e.g.
The following oligodeoxynucleotide primers were designed against the putative PfPP5 sequence found on chromosome 13 (AL049185; Plasmodium falciparum chr13_002073): ATGTTACACAACCATGATGTAGAAGAAG;TAAATGTTTTGATACAAATTATGAGC.
Lastly, traditional genetic manipulation in eukaryotes, including the Apicomplexa, is a relatively difficult and elaborate procedure [ 45 46 ] . Thus, we believe that the RNAi strategy will become a powerful and convenient tool in Plasmodium functional genomics, particularly in the studies of phylogenetically conserved signalling molecules.