Words similar to plasmodium

Example sentences for: plasmodium

How can you use “plasmodium” in a sentence? Here are some example sentences to help you improve your vocabulary:

Anopheles gambiae is the most important vector of Plasmodium falciparum malaria in Africa, where nearly 90% of the world's malaria-specific mortality occurs.
The following oligodeoxynucleotide primers were designed against the putative PfPP5 sequence found on chromosome 13 (AL049185; Plasmodium falciparum chr13_002073): ATGTTACACAACCATGATGTAGAAGAAG;TAAATGTTTTGATACAAATTATGAGC.
To our knowledge, PfPP5 is the only TPR-containing Plasmodium protein reported at this time.
Lastly, traditional genetic manipulation in eukaryotes, including the Apicomplexa, is a relatively difficult and elaborate procedure [ 45 46 ] . Thus, we believe that the RNAi strategy will become a powerful and convenient tool in Plasmodium functional genomics, particularly in the studies of phylogenetically conserved signalling molecules.
We then resorted to the electroporation procedure originally developed for DNA transfection in Plasmodium by Wellems and co-workers [ 32 ] , as detailed under Materials and Methods.