Words similar to ovt
Example sentences for: ovt
How can you use “ovt” in a sentence? Here are some example sentences to help you improve your vocabulary:
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
The lexA-GFP/peptide library (lVT560) was created with oligos oVT335 (TCGAGAGTGCAGGT (NN (G/C/T))15 GGAGCTTCTG), oVT336 (ACCTGCACTC), and oVT337 (GATCCAGAAGCTCC) in the manner described in (Abedi et.
Loading...