Example sentences for: osb
How can you use “osb” in a sentence? Here are some example sentences to help you improve your vocabulary:
The fragment, corresponding to -127 to +62 relative to the start of transcription, was amplified by PCR using primers 5'GAACGGTCTAGAATATATTGGC'3 (oSB15) and 5'GGGAATTCGCTATATAGGCTTGTATACATCGAA'3 (oSB14) with plasmid pPC25 as template.
A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).