Words similar to nucleotides

Example sentences for: nucleotides

How can you use “nucleotides” in a sentence? Here are some example sentences to help you improve your vocabulary:

PCR products were generated using the following primer set: sense primer (5'TGACATCTGAGCTCTATGAGGGT3', GenBank AF365927 nucleotides 545-567) and antisense primer 5'CCCAGGGAGTCCTGGGCCCGGA3' (nucleotides 782-803).
For each of these frequency tables, the percentages of each of the nucleotides are determined for multiple alignments, where the most similar sequences are organized into the same alignment.
Oligos of 30 and 40 nucleotides were also used successfully, although signal strength was weaker (red dots on the gene list in Figure 7).
However, if the frequencies of the four nucleotides at each codon position can vary independently with GC content (subject to the constraint that the nucleotide frequencies at each position are constrained by a sum), it is necessary to characterize the regression lines of each base at each position to make predictions about the nucleotide composition of the set of constant bases at each position, and of the most likely states of variable bases for a given GC content.
A segment of 29 nucleotides that was identical with a segment in rat exon II was found, suggesting the insert was a 5' BDNF gene exon.