Example sentences for: krs

How can you use “krs” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Additionally, to test whether moderate overexpression of the lysyl tRNA synthetase gene affected accumulation, we compared control transformants to multicopy KRS1 transformants of the two strains.

  • This product, cloned into the Sma I restriction site of plasmid pRS423, generated plasmid pM1 in which KRS1 is oriented anti to HIS3 . Plasmids are summarized in Table 3.

  • The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).

  • KRS1 on a multicopy plasmid showed no significant alteration of ApppN levels in any sample.

  • Determination of ApppN and AppppN concentrations revealed that ApppN levels are substantially higher in hnt2 mutants than in isogenic wild-types at all time points and that plasmids conferring multiple copies of KRS1 did not increase ApppN or AppppN levels at any culture time point (Table 5).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast