Words similar to krs
Example sentences for: krs
How can you use “krs” in a sentence? Here are some example sentences to help you improve your vocabulary:
To survey dinucleoside polyphosphate induction as a function of potential stress conditions, strain BY71-6c was transformed with either pRS423 or pM1 (effectively hnt2Δ and hnt2Δ YEp KRS1 , respectively) and strain BY71-16d was transformed with the same plasmids (effectively HNT2Δ and HNT2Δ YEp KRS1 , respectively).
The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).
KRS1 on a multicopy plasmid showed no significant alteration of ApppN levels in any sample.
Strain BY71-6c was transformed with plasmids pRS423 and pM1 (multicopy KRS1 ) and cultures were grown as for measurement of dinucleoside polyphosphate levels.
As shown in Figure 2, tRNA-dependent lysine incorporation was increased 2.1-fold by expression of KRS1 from a multicopy plasmid.
Loading...