Words similar to krs

Example sentences for: krs

How can you use “krs” in a sentence? Here are some example sentences to help you improve your vocabulary:

As shown in Figure 2, tRNA-dependent lysine incorporation was increased 2.1-fold by expression of KRS1 from a multicopy plasmid.
KRS1 on a multicopy plasmid showed no significant alteration of ApppN levels in any sample.
Additionally, to test whether moderate overexpression of the lysyl tRNA synthetase gene affected accumulation, we compared control transformants to multicopy KRS1 transformants of the two strains.
The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).
This product, cloned into the Sma I restriction site of plasmid pRS423, generated plasmid pM1 in which KRS1 is oriented anti to HIS3 . Plasmids are summarized in Table 3.