Words similar to krs

Example sentences for: krs

How can you use “krs” in a sentence? Here are some example sentences to help you improve your vocabulary:

KRS1 on a multicopy plasmid showed no significant alteration of ApppN levels in any sample.
As shown in Figure 2, tRNA-dependent lysine incorporation was increased 2.1-fold by expression of KRS1 from a multicopy plasmid.
The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).
Additionally, to test whether moderate overexpression of the lysyl tRNA synthetase gene affected accumulation, we compared control transformants to multicopy KRS1 transformants of the two strains.
To survey dinucleoside polyphosphate induction as a function of potential stress conditions, strain BY71-6c was transformed with either pRS423 or pM1 (effectively hnt2Δ and hnt2Δ YEp KRS1 , respectively) and strain BY71-16d was transformed with the same plasmids (effectively HNT2Δ and HNT2Δ YEp KRS1 , respectively).