Words similar to krs

Example sentences for: krs

How can you use “krs” in a sentence? Here are some example sentences to help you improve your vocabulary:

Determination of ApppN and AppppN concentrations revealed that ApppN levels are substantially higher in hnt2 mutants than in isogenic wild-types at all time points and that plasmids conferring multiple copies of KRS1 did not increase ApppN or AppppN levels at any culture time point (Table 5).
To survey dinucleoside polyphosphate induction as a function of potential stress conditions, strain BY71-6c was transformed with either pRS423 or pM1 (effectively hnt2Δ and hnt2Δ YEp KRS1 , respectively) and strain BY71-16d was transformed with the same plasmids (effectively HNT2Δ and HNT2Δ YEp KRS1 , respectively).
Additionally, to test whether moderate overexpression of the lysyl tRNA synthetase gene affected accumulation, we compared control transformants to multicopy KRS1 transformants of the two strains.
The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).
Strain BY71-6c was transformed with plasmids pRS423 and pM1 (multicopy KRS1 ) and cultures were grown as for measurement of dinucleoside polyphosphate levels.