Example sentences for: intronic

How can you use “intronic” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Instead, yet-undetermined cis -acting intronic sequences may be responsible.

  • One silent polymorphism and eight previously unreported intronic alterations were also found.

  • For each module, all nearby genes were extracted from the annotation, their position relative to the module (ie up/down stream, intronic), and Flybase links for gene function were collected into a table.

  • The ten longest intronic CSEs (see Supplementary Table 1 in the additional data file) within known human genes, including RefSeq genes and other genes with known mRNA sequences, were further examined and compared with the human golden path annotation [ 12].

  • PCR primers (prdap25: cacctccaggatgtgttagc and prdazp26:gtcaccaagggtgtctgaag) were designed from intronic sequences flanking Dazap1 exon 8. These primers amplified a 271 bp fragment from mouse but not hamster genomic DNA.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast