Words similar to introduced

Example sentences for: introduced

How can you use “introduced” in a sentence? Here are some example sentences to help you improve your vocabulary:

Therefore, we have also introduced another approach using bivariate statistics to represent the molecular cycles more completely [ 32 ] . In this approach, the record of each specimen is represented as the tip of a vector whose direction indicates the mean phase estimate (as above) and whose distance from the origin in the x-y plane represents intraspecimen variability (see Figures 7, 8).
Gore is the one who introduced Willie Horton to American politics in the 1988 primary against Mike Dukakis.
The forward primer, 5'ACTGACGAATTCAGCCACCATGGCGCTCCTGCTGTGC3' introduced an EcoRI site and the reverse primer, 5'GTCAGTCCCGGGTCAGTCAGCTACTTTTTACGACAGCAAAAGAT3' introduced stop codons in three reading frames and a SmaI site.
Over time, the likelihood of such a mutation being introduced increases.
Eight days later, the GOP leadership introduced a list of legislative initiatives which adopted Microsoft's view of antitrust law.