Words similar to i-x

Example sentences for: i-x

How can you use “i-x” in a sentence? Here are some example sentences to help you improve your vocabulary:

, 1985) was cut with Hind III and Aat II and the 2170 bp fragment containing the β-lactamase gene and the ColE1 replication origin was isolated, and two different synthetic double stranded oligonucleotides were inserted (order of restriction sites Hind III-Asc I-EcoR I-Xho I-Sfi I/Bgl I-T7promoter-Aat II).
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.