Words similar to his-

Example sentences for: his-

How can you use “his-” in a sentence? Here are some example sentences to help you improve your vocabulary:

These results further support the view that induced PP1α behaves similarly if not identically to endogenous PP1α, and provides a possible mechanistic explanation for 6His-HA-PP1α localization to the nucleus.
Immunoblot analysis of the precipitates with anti-FLAG antibodies detected a higher molecular weight smear only upon co-expression of FLAG-COP1 and His-Ub, therefore confirming that COP1 is indeed a ubiquitination substrate (Fig.
Indeed, a time course of induction followed by western blotting of whole cell lysates using antibody to PP1α revealed diminution of the endogenous PP1α signal after 4 hr of induction, while the 6His-HA-PP1α signal increased (Figure 8).
cDNA was resuspended in 20 ul water and used in a 30-cycle PCR reaction with 1 uM of each of the following four primers: {CCACGCTGTTTTGACCTCCATAGAAGACAC, CACATAGTCCCCCAGAAAGAGGTAGTTGCT}, in which product only forms from 6His-HA-PP1α cDNA, and {GACGCGGGCAAGCAGTCCCTCGAGACCATTGCCTGCTG, CTGGAGACCCACGACCTGGCCTGCCGTTG}, in which product only forms from endogenous PP1α cDNA.
The two experimental groups received intrathecally 10 μl of a mixture containing 10 μM of thiorphan and 20 μM of kelatorphan (to delay the degradation of the peptide ligand) and 10 μM of dermenkephalin (Tyr-D-Met-Phe-His-Leu-Met-Asp-NH 2 , Sigma, a selective δ agonist ( 14, 34)), in 0.9% NaCl.