Example sentences for: glu

How can you use “glu” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • This substantiates previous mutagenesis studies, which demonstrated that repulsive interactions and/or lack of productive electrostatic interactions between Glu39 and Glu192 of thrombin and PAI-1 are responsible for the slow reaction of thrombin with this serpin.

  • a and one Chl b [ 35 ] . Rogl and Kühlbrandt [ 34 ] suggested that Glu65 (in an ion-pair with Arg185) may be a ligand for Chl b, with another site, occupied by Chl

  • With single mutation at position Glu351, we improved reactivity of PAI-1 to thrombin and plasmin without significantly affecting its specificity to tPA.

  • Cys→Ser mutation at position 280 in the p51 subunit has been shown to alter the RNase H activity of the heterodimeric enzyme, indicating that this residue in the thumb subdomain of p51 plays an important role in support of the RNase H activity of p66 [ 22 ] . The emergence of a strain of HIV-1 resistant to the non-nucleoside RT inhibitor TSAO (Tertbutyldimethyl silyspiro amino oxathioledioside) displaying Glu→Lys mutation at position 138 in the p51 subunit of HIV-1 RT has also been reported [ 23 ] , thus implicating p51 to play a more direct role in drug binding and/or the enzymatic activities of HIV-1RT.

  • The extracellular domain (amino acid residues Glu 24-His 159) of monkey proHB-EGF (GenBank accession number Q09118) [ 2 ] was amplified by PCR using primers MkHB-EGF ex (5') TCGGCACTGGTGGAATTCGAGAGCCTGGAG and MKHB-EGF ex (3') CACAGCCAGGATGGATCCATGGTCATAGGT.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast