Example sentences for: ggagaagtctgtgatcgccaagaagctgga

How can you use “ggagaagtctgtgatcgccaagaagctgga” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • In a seperate reaction, sense primer 5'GGAGAAGTCTGTGATCGCCAAGAAGCTGGA3' was paired with antisense primer (nt 3100 to nt 3081).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast