Words similar to ggaccaccgcctcgcctctc
Example sentences for: ggaccaccgcctcgcctctc
How can you use “ggaccaccgcctcgcctctc” in a sentence? Here are some example sentences to help you improve your vocabulary:
Nested PCR was then done to eliminate the possibility of artifacts using the GeneRacer 5' nested primer and p27 Kip1primers CACGACCGCCTCTCTCGCACTCTC for human and GGACCACCGCCTCGCCTCTC for mouse (see Figs.
Loading...