Words similar to gfp

Example sentences for: gfp

How can you use “gfp” in a sentence? Here are some example sentences to help you improve your vocabulary:

Flow cytometric analysis determined that the transferred population of Ad-transduced cells from DO11.hCARΔcyt Tg donors retained the pre-transfer frequencies of GFP +and GFP -cells within the DO11.
prad26reverse : GATGTGGGTGCGGGACGGGAAAGAACAACACTGAAGAAACAAGTATCATTATTTCATTTGAAAAATTAGGGAAATGAATTCGAGCTCGTTTAAAC) were used to amplify the GFP (S65T)-kanMX6 module of pFA6a-GFP (S65T)-kanMX6 [ 41 ] in ten separate 50 μl PCR reactions using Accuzyme, high-fidelity polymerase (Bioline, Randolph, MA).
Therefore, the checkpoint Rad proteins are not required for proper localization of Rad26-GFP in cycling cells.
For such a screen, haploid strains expressing chromosomally integrated GFP fusions to both NIC96 and NUP170 were generated (see Materials and Methods).
Correct chromosomal integration was confirmed by fluorescence microscopy and immunoblotting with anti-GFP antibodies (rabbit affinity purified IgG; kindly provided by M. Linder, Washington University School of Medicine, St. Louis, MO).