Example sentences for: geneticin-resistance

How can you use “geneticin-resistance” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Rad26-GFP was followed through crosses using Geneticin-resistance and Western blotting to confirm that

  • Markers segregated 2:2 in nearly all cases and possession of a 1976 bp PCR fragment using primers 4726 and 4722 always correlated with geneticin-resistance while possession of a 1200 bp product correlated with geneticin-sensitivity, as expected for segregants containing a nondisrupted HNT2 gene.

  • A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.

  • To ensure that geneticin-resistance was linked to hnt2 disruption, genomic DNA from several geneticin-resistant colonies was analyzed by diagnostic PCR primers 4726 (5'TCGCTGATTTGGTAGTCTC) and 4722 (5'GAGTCTCCTCGAGGAAAG).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast