Words similar to geneticin-resistance

Example sentences for: geneticin-resistance

How can you use “geneticin-resistance” in a sentence? Here are some example sentences to help you improve your vocabulary:

To ensure that geneticin-resistance was linked to hnt2 disruption, genomic DNA from several geneticin-resistant colonies was analyzed by diagnostic PCR primers 4726 (5'TCGCTGATTTGGTAGTCTC) and 4722 (5'GAGTCTCCTCGAGGAAAG).
Markers segregated 2:2 in nearly all cases and possession of a 1976 bp PCR fragment using primers 4726 and 4722 always correlated with geneticin-resistance while possession of a 1200 bp product correlated with geneticin-sensitivity, as expected for segregants containing a nondisrupted HNT2 gene.
Rad26-GFP was followed through crosses using Geneticin-resistance and Western blotting to confirm that
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.