Words similar to geneticin

Example sentences for: geneticin

How can you use “geneticin” in a sentence? Here are some example sentences to help you improve your vocabulary:

A stable BS-C-1 cell line was made by transfection of GFP-Arp3 (gift from D. Schafer as described [ 34 ] ) using Fugene6 (Roche) and selection with 500 ug/ml Geneticin.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
This DNA was then used to transform TE696 ( rad26 +) and TE1102 ( rad26.T12 ) to Geneticin (Life Technologies, Rockville, MD) - resistance as described by Bahler et al.
Stable lines expressing EGFP-cPLA 2 were generated by growing transfected cells in growth medium for 3 d, supplementing the growth medium with 5 mg/ml Geneticin (antibiotic G418-sulfate), and culturing for an additional 2 wk in Geneticin.
Transformations were performed by electroporation [ 39 ] and transformed cells were selected by 7.5 μg/ml G418 (Geneticin; Life Technologies, Gaithersburg, MD).