Example sentences for: geneticin

How can you use “geneticin” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Stable clones were selected using 400 μg/ml Geneticin ®. Single clone were picked and tested for expression of δ opioid receptor by binding assay.

  • Adherent cells were transduced with an amphotropic retrovirus, DFG-hIL-1β-neo, which encodes the mature form of human IL-1β fused to the leader sequence of human parathyroid hormone to enable efficient secretion, and neomycin phosphotransferase [ 21 ] . Retroviral transductants were positively selected in complete DMEM containing Geneticin at 0.5 mg/ml.

  • A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.

  • All ES cell lines were cultured on mitotically inactivated primary embryonic fibroblasts in ES cell medium supplemented with recombinant leukemia inhibitory factor (LIF) as described elsewhere [ 22 ] . F3 cells were generated by introducing 100 μg of Not1 digested pΔHPRT plasmid into 1.5 × 10 8R1 ES cells by electroporation at 250 volts/500μf/resistance 8 using a BTX ECM600 electroporation system [ 7 ] . Cells containing neo were selected by supplementing the ES cell medium with 250 μg/ml Geneticin (G418, Gibco-BRL) and negative selection against Hsv-tk gene expression was achieved by including 2 μM gancyclovir (Roche).

  • A stable BS-C-1 cell line was made by transfection of GFP-Arp3 (gift from D. Schafer as described [ 34 ] ) using Fugene6 (Roche) and selection with 500 ug/ml Geneticin.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast