Words similar to geneticin
Example sentences for: geneticin
How can you use “geneticin” in a sentence? Here are some example sentences to help you improve your vocabulary:
Stable lines expressing EGFP-cPLA 2 were generated by growing transfected cells in growth medium for 3 d, supplementing the growth medium with 5 mg/ml Geneticin (antibiotic G418-sulfate), and culturing for an additional 2 wk in Geneticin.
Cells containing Neo were selected by supplementing the ES cell medium with 300 μg/ml Geneticin (G418,Gibco-BRL) and negative selection against Hsv-tk gene expression was achieved by including 2 μM gancyclovir (Roche).
All ES cell lines were cultured on mitotically inactivated primary embryonic fibroblasts in ES cell medium supplemented with recombinant leukemia inhibitory factor (LIF) as described elsewhere [ 22 ] . F3 cells were generated by introducing 100 μg of Not1 digested pΔHPRT plasmid into 1.5 × 10 8R1 ES cells by electroporation at 250 volts/500μf/resistance 8 using a BTX ECM600 electroporation system [ 7 ] . Cells containing neo were selected by supplementing the ES cell medium with 250 μg/ml Geneticin (G418, Gibco-BRL) and negative selection against Hsv-tk gene expression was achieved by including 2 μM gancyclovir (Roche).
The EGFP-positive cells were maintained in growth medium supplemented with 5 mg/ml Geneticin.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
Loading...