Words similar to generacer

Example sentences for: generacer

How can you use “generacer” in a sentence? Here are some example sentences to help you improve your vocabulary:

The cDNA was amplified with the GeneRacer primer and a BDNF primer, P1, complementary to 18 nucleotides near the 5' end of the coding exon.
PCR was done to amplify the resultant cDNAs using the GeneRacer 5' primer and a primer consisting of bases immediately upstream of the translation start site of the p27 Kip1gene (CTTTCTCCCGGGTCTGCACGACCG for human and CTTCCTCCTCGGGCGGGTGT for mouse).
Amplified cDNA was generated using the Invitrogen GeneRacer kit according to the manufacturer's directions http://www.invitrogen.com.
Half-nested PCR was then performed using the internal 5' GeneRacer primer and P1.
Nested PCR was then done to eliminate the possibility of artifacts using the GeneRacer 5' nested primer and p27 Kip1primers CACGACCGCCTCTCTCGCACTCTC for human and GGACCACCGCCTCGCCTCTC for mouse (see Figs.