Example sentences for: gattctgrcttagaggcgttc

How can you use “gattctgrcttagaggcgttc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • PCR reactions were done with the following primers: 1825- 5'GTGATTTCTGCCCAGTGCTC 3', 2252- 5'TTTAACAGATGTGCCGCC 3', 2252- 5'GGCGGCACATCTGTTAAA 3', and 2746- 5'GATTCTGRCTTAGAGGCGTTC 3'.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast