Example sentences for: gatgtggccatcacattcgtcagat

How can you use “gatgtggccatcacattcgtcagat” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The insertion/deletion genotype of subjects was performed using purified genomic DNA (prepared as above) and the polymerase chain reaction using the forward primer 5'CTGGAGACCACTCCCATCCTTTCT3' and the reverse primer 5'GATGTGGCCATCACATTCGTCAGAT3' as per Rigat et al [ 13].


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast