Words similar to forward-
Example sentences for: forward-
How can you use “forward-” in a sentence? Here are some example sentences to help you improve your vocabulary:
The PCR-Select cDNA Subtraction and PCR-Select Differential Screening Kits (Clontech Laboratories Inc.) were used to enrich for and identify differentially expressed genes in the driver and tester cDNAs [ 48 49 ] . Both forward- and reverse-subtraction were performed; untreated HUVEC cDNA served as driver and VEGF-treated HUVEC cDNA served as tester in the former, whereas untreated HUVEC cDNA served as tester and VEGF-treated HUVEC cDNA served as driver in the latter [ 48 49 ] . Target cDNA fragments were amplified using the Marathon™ cDNA Amplification Kit, subcloned into pCR ®2.
By employing forward- and reverse-subtraction, we identified both common (indicated by arrows) and differentially expressed genes (Fig.
DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.
--Forward-Looking in New York