Words similar to forward-
Example sentences for: forward-
How can you use “forward-” in a sentence? Here are some example sentences to help you improve your vocabulary:
DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.
The PCR-Select cDNA Subtraction and PCR-Select Differential Screening Kits (Clontech Laboratories Inc.) were used to enrich for and identify differentially expressed genes in the driver and tester cDNAs [ 48 49 ] . Both forward- and reverse-subtraction were performed; untreated HUVEC cDNA served as driver and VEGF-treated HUVEC cDNA served as tester in the former, whereas untreated HUVEC cDNA served as tester and VEGF-treated HUVEC cDNA served as driver in the latter [ 48 49 ] . Target cDNA fragments were amplified using the Marathon™ cDNA Amplification Kit, subcloned into pCR ®2.
--Forward-Looking in New York
By employing forward- and reverse-subtraction, we identified both common (indicated by arrows) and differentially expressed genes (Fig.
Loading...