Example sentences for: forward-

How can you use “forward-” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • --Forward-Looking in New York

  • The PCR-Select cDNA Subtraction and PCR-Select Differential Screening Kits (Clontech Laboratories Inc.) were used to enrich for and identify differentially expressed genes in the driver and tester cDNAs [ 48 49 ] . Both forward- and reverse-subtraction were performed; untreated HUVEC cDNA served as driver and VEGF-treated HUVEC cDNA served as tester in the former, whereas untreated HUVEC cDNA served as tester and VEGF-treated HUVEC cDNA served as driver in the latter [ 48 49 ] . Target cDNA fragments were amplified using the Marathon™ cDNA Amplification Kit, subcloned into pCR ®2.

  • DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.

  • By employing forward- and reverse-subtraction, we identified both common (indicated by arrows) and differentially expressed genes (Fig.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast