Words similar to egfp

Example sentences for: egfp

How can you use “egfp” in a sentence? Here are some example sentences to help you improve your vocabulary:

An 8x polyhistidine epitope tag was added to the N-terminus of EGFP with an oligonucleotide adapter (5'AAAACTGCAGCGGCCGCCACCATGCACCAC-CACCACACCACCACCACGTGAGCAAGGGCGAGGAGCTGTTCACCG3').
Quantitation of retroviral titer by flow cytometry based expression analysis for EGFP
To determine how efficiently co-transfection occurred with PEI, we used β-gal and EGFP together in a 1: 1 ratio, with the overall DNA: PEI ratio at 2 μg plasmid DNA: 5 μg PEI/ml culture media.
Direct fluorescence from EGFP and indirect immunofluorescence using the amplification protocol with anti-EGFP antibody were compared.
The Tn 5 MEs were added to the 5' and 3' ends of an EGFP coding sequence, with a Srf I restriction site at its 3' end, such that one continuous reading frame extended through both MEs and EGFP (figure 2).