Words similar to egfp

Example sentences for: egfp

How can you use “egfp” in a sentence? Here are some example sentences to help you improve your vocabulary:

This assay takes advantage of the fluorescent properties of the EGFP transgene.
Cells expressing EGFP fluorescence were selected using a fluorescence-activated cell sorter.
An 8x polyhistidine epitope tag was added to the N-terminus of EGFP with an oligonucleotide adapter (5'AAAACTGCAGCGGCCGCCACCATGCACCAC-CACCACACCACCACCACGTGAGCAAGGGCGAGGAGCTGTTCACCG3').
EGFP was imaged with an FITC filter set, while ECFP was distinguished from EGFP in co-expression experiments by changing both the excitation and emission filter sets (Exciters: 440AF21 & 500AF25, Dichroic cat# XF 2063, Emitters 480AF & 545AF35; Omega, Brattleboro, VT).
cfu = colony forming units; COX-2 = cyclooxygenase-2; DMEM = Dulbecco's modified Eagle's medium; EGFP = enhanced green fluorescent protein; FACS = fluorescence-activated cell sorting; FLS = fibroblast-like synovial cells; MoMLV = Moloney murine leukemia virus; PCR = polymerase chain reaction; RA = rheumatoid arthritis; RCF = relative centrifugal force.