Words similar to egfp

Example sentences for: egfp

How can you use “egfp” in a sentence? Here are some example sentences to help you improve your vocabulary:

An 8x polyhistidine epitope tag was added to the N-terminus of EGFP with an oligonucleotide adapter (5'AAAACTGCAGCGGCCGCCACCATGCACCAC-CACCACACCACCACCACGTGAGCAAGGGCGAGGAGCTGTTCACCG3').
[ 36 ] using an upper primer complimentary to the 5' UTR (5'-GCTCCCGCGGCTCCTGCTCTGCTC-3'), and a lower primer complimentary to EGFP (5'-GCCGTCGCCGATGGGGGTGTTCTG-3'.
Cultures of cells dissociated from adult human retina were transfected with plasmid encoding EGFP after 1-4 weeks in vitro using the same protocol developed for sympathetic neurons.
Different fluorescent-protein tagged constructs were produced by exchanging the NheI/BsrGI fragment containing the fluorescent protein coding sequence between EGFP, EYFP, and ECFP.
Titer (cfu/ml) = (2 × 10 5target cells) × (% EGFP+ cells)/ volume of supernatant (ml).