Words similar to egf-like
Example sentences for: egf-like
How can you use “egf-like” in a sentence? Here are some example sentences to help you improve your vocabulary:
Fibulin-1 has been reported two exhibit calcium-dependent self-association [ 40 44 ] . The two self-association sites map to type II EGF-like modules 5 and 6 and to a cryptic site in the amino-terminal region of fibulin-1 [ 40 44 ] .
The precursor of heparin-binding EGF-like growth factor (proHB-EGF) is found on a wide variety of cell surfaces and is present in numerous tissue types [ 1 ] . Previously in our laboratory, we cloned the cDNA encoding proHB-EGF from monkey Vero cells and identified this cell-surface molecule as a receptor for diphtheria toxin (DT) [ 2 ] . The predicted amino acid sequence was shown to be identical to that of the cell surface-expressed precursor of human heparin-binding EGF-like growth factor (proHB-EGF) [ 3 4 ] . The derived amino acid sequence revealed a signal sequence (residues 1-23), an extracellular domain (residues 24-159), a transmembrane domain (residues 160-184), and a carboxyl terminal cytoplasmic domain (residues 185-208) [ 2 ] . Proteolytic processing of the proHB-EGF occurs on the cell surface and results in the release of mature HB-EGF (mHB-EGF) (residues 63-148) [ 5 ] . The mature/soluble HB-EGF is a member of the EGF family of growth factors that includes amphiregulin, epidermal growth factor, and transforming growth factor a [ 6 ] . Mature HB-EGF released from the cell surface is mitogenic and is able to bind to the EGF receptor [ 3 ] . Membrane-bound proHB-EGF has juxtacrine growth factor activity [ 7 ] and also acts as a DT receptor [ 2 8 ] .
A constructed clone, pGAD424/LTBP-3 EGF#1-8, that contained calcium-binding type EGF-like modules #1-8 fused to the GAL4-activation domain (see Fig.
The EGF-like region (amino acid residues Asp 106-His 159) of monkey proHB-EGF [ 2 ] was amplified by PCR using primers MkHB-EGF 5'CTAGGGAAGGAATTCGACCCATGTCTTCGG and MkHB-EGF 3'CACAGCCAGGATGGATCCTCAATGGTCATAGG.
Nidogen is a basement membrane protein composed of three globular domains G1-G3 and two linking sequences; domain G1 is joined to domain G2 through a flexible link and domain G2 is connected to domain G3 by a rod-like element consisting of EGF-like modules [ 47 ] . Nidogen1 is an important structural component of tertiary complexes with other such extracellular components as laminins, collagen IV, perlecan, and fibulins [ 48 ] . Fibulin-1C binds to nidogen1 through domain G2 of nidogen [ 48 ] . The nidogen binding site of fibulin-1C includes the type II EGF-like modules 6-9 and the carboxyl-terminal domain [ 42 ] .
Loading...