Words similar to egf-like

Example sentences for: egf-like

How can you use “egf-like” in a sentence? Here are some example sentences to help you improve your vocabulary:

Deletion of one EGF-like domain due to exon skipping, especially in the region between exon 24 and 32, usually causes severe neonatal-onset MFS [ 8 24 25 ] . Similar deletions in other regions of fibrillin-1 may also result in early onset of cardiovascular symptoms [ 8 ] . Patient 1, described here, had a genomic deletion of exons 42 and 43 that results in an in-frame deletion of part of the 5th LTBP-like domain and the adjacent downstream cbEGF-like domain.
A clone, pGAD424/Fib-1C EGF #5-COOH, that contained calcium-binding type EGF-like modules #5-9 and the carboxyl-terminus of fibulin-1C fused to the GAL4-activation domain (see Fig.
The amino acid sequence of the heparin-binding region of HB-EGF ( 21KRKKKGKGLGKKRDPCLRKYK 41) [ 2 ] has been shown to have a strong affinity for heparin and may influence the interaction of this growth factor with cell-surface negatively charged heparan sulfate proteoglycans [ 22 ] . It remains to be seen whether specific/all of the EGF-like modules are required and whether calcium is needed for the interaction of HB-EGF with LTBP-3.
Thus, it appears that deletion of three contiguous EGF-like domains can have different effects depending on their location within the fibrillin-1 molecule.
The EGF-like region (amino acid residues Asp 106-His 159) of monkey proHB-EGF [ 2 ] was amplified by PCR using primers MkHB-EGF 5'CTAGGGAAGGAATTCGACCCATGTCTTCGG and MkHB-EGF 3'CACAGCCAGGATGGATCCTCAATGGTCATAGG.