Example sentences for: ebp

How can you use “ebp” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • In normal mitogen-activated cells eIF4E activity is enhanced due to elevated transcription of the eIF4E gene, a phosphorylation-dependent increase in affinity for the 7-methylguanosine cap, and phosphorylation-dependent inactivation of the inhibitor protein 4EBP.

  • Electrophoretic mobility shifts assays were done by mixing a radiolabeled oligonucleotide containing a consensus, high affinity C/EBP binding site (GATCGAGCCCCATTGCGCAATCATAGATC) together with extracts prepared from transfected cells as previously described [ 58 59 ] . Competition with the same, unlabeled oligonucleotide in 1, 10 or 100 molar excess of the radiolabeled probed indicated specific binding.

  • A portion of the cellular eIF4E is imported into the nucleus through a mechanism that requires the protein 4E-T [ 31 ] . In the nucleus eIF4E is localized to specific nuclear bodies and associates with promyelocytic leukemia protein (PML, [ 32 ] ). Nuclear eIF4E appears to be involved in export of cyclin D1 mRNA to the cytosol [ 25 ] . Both 4E-T and PML interact with the same domain of eIF4E that binds 4EBP [ 32 ] . Thus expression of constitutively active 4EBP may block nuclear functions of eIF4E, one consequence being a reduction in cyclin D1 mRNA that can be translated in the cytoplasm.

  • The No C/EBP controls also indicated the extent to which green fluorescent, C/EBPα-expressing cells were distinguished from non-expressing cells by flow cytometry.

  • Thus there is interest in using this class of inhibitors for chemotherapeutic treatment of cancer and several phase I trials have been carried out [ 22 ] . Treatment of mammalian cells with rapamycin leads to dephosphorylation and activation of 4EBP, which in turn binds to and inhibits eIF4E.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast