Words similar to ebp
Example sentences for: ebp
How can you use “ebp” in a sentence? Here are some example sentences to help you improve your vocabulary:
A portion of the cellular eIF4E is imported into the nucleus through a mechanism that requires the protein 4E-T [ 31 ] . In the nucleus eIF4E is localized to specific nuclear bodies and associates with promyelocytic leukemia protein (PML, [ 32 ] ). Nuclear eIF4E appears to be involved in export of cyclin D1 mRNA to the cytosol [ 25 ] . Both 4E-T and PML interact with the same domain of eIF4E that binds 4EBP [ 32 ] . Thus expression of constitutively active 4EBP may block nuclear functions of eIF4E, one consequence being a reduction in cyclin D1 mRNA that can be translated in the cytoplasm.
C; catalytic subunit, cAMP; cyclic adenosine monophosphate, CAT; chloramphenicol acetyl transferase, C/EBP; CAAT/enhancer binding protein, ChoRE; carbohydrate response element, CMV; cytalomega virus, 8-CPT-cAMP; 8-(4-chlorophenyl)thio-cAMP, CREB; cAMP-response element binding protein, EMSA; electrophoretic mobility shift assay, FAS; fatty acid synthase, FSH; follicle stimulating hormone, GIRE; glucose/insulin response element, hCG; human chorionic gonadotrophin, HLH; helix-loop-helix, IRE; insulin response element, MHC; major histocompability complex, PGHS; prostaglandin G/H synthase, PKA; cAMP-dependent protein kinase, R; regulatory subunit, USF; upstream stimulating factor, WB; Western blot.
Electrophoretic mobility shifts assays were done by mixing a radiolabeled oligonucleotide containing a consensus, high affinity C/EBP binding site (GATCGAGCCCCATTGCGCAATCATAGATC) together with extracts prepared from transfected cells as previously described [ 58 59 ] . Competition with the same, unlabeled oligonucleotide in 1, 10 or 100 molar excess of the radiolabeled probed indicated specific binding.
Thus, whereas CREB activity peaked 0.5 hours after endotoxin administration, C/EBP binding activity was maximal at 12 hours.
Overexpression of eIF4E leads to deregulated growth and malignant transformation of a variety of cultured cell lines [ 12 13 14 ] . Moreover, elevated levels of eIF4E are commonly found in solid tumors, especially in breast, colon, and head and neck tumors [ 15 ] . Clinical studies indicate that eIF4E gene amplification and protein overexpression is associated with malignant progression in these tumors [ 16 ] . High eIF4E levels are also associated with a higher rate of cancer recurrence and cancer-related death [ 17 ] . In contrast to eIF4E, overexpression of 4EBP inhibits cell proliferation [ 18 ] and 4EBP-1 expression levels are inversely correlated with the progression of certain types of tumors [ 19 ] .
Loading...