Words similar to ebp
Example sentences for: ebp
How can you use “ebp” in a sentence? Here are some example sentences to help you improve your vocabulary:
In normal mitogen-activated cells eIF4E activity is enhanced due to elevated transcription of the eIF4E gene, a phosphorylation-dependent increase in affinity for the 7-methylguanosine cap, and phosphorylation-dependent inactivation of the inhibitor protein 4EBP.
Electrophoretic mobility shifts assays were done by mixing a radiolabeled oligonucleotide containing a consensus, high affinity C/EBP binding site (GATCGAGCCCCATTGCGCAATCATAGATC) together with extracts prepared from transfected cells as previously described [ 58 59 ] . Competition with the same, unlabeled oligonucleotide in 1, 10 or 100 molar excess of the radiolabeled probed indicated specific binding.
A portion of the cellular eIF4E is imported into the nucleus through a mechanism that requires the protein 4E-T [ 31 ] . In the nucleus eIF4E is localized to specific nuclear bodies and associates with promyelocytic leukemia protein (PML, [ 32 ] ). Nuclear eIF4E appears to be involved in export of cyclin D1 mRNA to the cytosol [ 25 ] . Both 4E-T and PML interact with the same domain of eIF4E that binds 4EBP [ 32 ] . Thus expression of constitutively active 4EBP may block nuclear functions of eIF4E, one consequence being a reduction in cyclin D1 mRNA that can be translated in the cytoplasm.
The No C/EBP controls also indicated the extent to which green fluorescent, C/EBPα-expressing cells were distinguished from non-expressing cells by flow cytometry.
Thus there is interest in using this class of inhibitors for chemotherapeutic treatment of cancer and several phase I trials have been carried out [ 22 ] . Treatment of mammalian cells with rapamycin leads to dephosphorylation and activation of 4EBP, which in turn binds to and inhibits eIF4E.
Loading...