Words similar to ebp
Example sentences for: ebp
How can you use “ebp” in a sentence? Here are some example sentences to help you improve your vocabulary:
Binding reactions were carried out at room temperature for 30 min in a total volume of 15 μl and contained 2-5 μg of nuclear extracts, 5 μl of 5X gel shift binding buffer (20% glycerol, 5 mM MgCl 2 , 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris-HCl, pH 7.5), 2 μg poly (dI-dC) and 3 × 10 4cpm/μl of [ 32P] labeled CREB (5'-AGA GAT TGC CTG ACG TCA GAG AGC TAG-3'), NF-κB (5'-AGT TGA GGG GAC TTT CCC AGG C-3') (Promega Gel Shift Assay Systems, Madison, WI, USA) or CCAAT/enhancer binding protein (C/EBP) (5'-TGC AGA TTG CGC AAT CTG CA-3') (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) oligonucleotides.
Inhibiting the expression of eIF4E by expressing antisense RNA reverses ras-mediated transformation of cultured cells as indicated by decreased efficiency of growth in soft agar and tumor formation in nude mice [ 20 ] . Similarly, antisense-mediated reduction of eIF4E in breast cancer cells inhibits both their tumorigenic and angiogenic properties [ 21 ] . On the other hand, overexpression of 4EBP reverses transformation mediated by v-src [ 18 ] .
Administration of endotoxin to the animals also induced C/EBP nuclear binding activity.
Electrophoretic mobility shifts assays were done by mixing a radiolabeled oligonucleotide containing a consensus, high affinity C/EBP binding site (GATCGAGCCCCATTGCGCAATCATAGATC) together with extracts prepared from transfected cells as previously described [ 58 59 ] . Competition with the same, unlabeled oligonucleotide in 1, 10 or 100 molar excess of the radiolabeled probed indicated specific binding.
4EBP phosphorylation is thought to be mediated by mammalian target of rapamycin (mTOR) in mitogen stimulated cells [ 9 10 11 ] .
Loading...