Example sentences for: designed

How can you use “designed” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The National Trust and the National Park Authority both work on conservation projects and these, along with innovative transportation policies devised by local councils, are all designed to help minimize the potential negative impact of tourism.

  • The primers used for methylated and unmethylated-specific PCR for genes RARB , TIMP3 , CDKN2A , p14 ARF , MGMT , DAPK , CDH1 , GSTP1 , APC promoter 1A, RB1 , MLH1 , TP73 , BRCA1 , FHIT , and HIC1 have been described previously http://pathology2.jhu.edu/pancreas/prim0425.htm#MSP; [ 34 35 36 37 ] . For additional genes, we designed the following gene-specific primers for methylated (MF and MR) and unmethylated (UF and UR) sequences according to Herman et al [ 33 ] :

  • Designed specifically for the special forces, the version of the AC-130 known as "Spooky"can fly in fast or from high altitude, undetected by radar; guided to its zone by extraordinarily complex electronics, it is capable of rapidly firing precision-guided 25, 40, and 105 mm projectiles.

  • The PCR primers (Table 2) were designed to contain restriction enzyme sites for cloning of the amplicon into the pHIP vector downstream of the hsp65 promoter as well as the eight basepairs (bp) upstream of the start codon of the gene being cloned.

  • PCR primers (prdap25: cacctccaggatgtgttagc and prdazp26:gtcaccaagggtgtctgaag) were designed from intronic sequences flanking Dazap1 exon 8. These primers amplified a 271 bp fragment from mouse but not hamster genomic DNA.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast