Words similar to designed
Example sentences for: designed
How can you use “designed” in a sentence? Here are some example sentences to help you improve your vocabulary:
The following oligodeoxynucleotide primers were designed against the putative PfPP5 sequence found on chromosome 13 (AL049185; Plasmodium falciparum chr13_002073): ATGTTACACAACCATGATGTAGAAGAAG;TAAATGTTTTGATACAAATTATGAGC.
Objective evaluation of their training necessitated adherence to standard approaches designed for the type 2 learners.
Finally, we propose that the positively selected viral variants (as opposed to all viral variants) should be included in future, highly multivalent vaccines designed to compensate for B-cell-selected antigenic drift.
Abaco Gold is a range of jewelry designed and sold only in the Bahamas and unusual pieces such as rare gold and silver coins brought from treasure found on the seabed, and mounted in gold to be worn as pendants or brooches.
Thus the present study was designed, (1) to describe the activation profiles of a set of opioid ligands not previously defined at an isolated cell system expressing only δ opioid receptors, and (2) to compare the relative efficacies and potencies of these ligands to the strongest ligand in the set, metazocine, to the common opioid analgesic, morphine and to the endogenous δ opioid ligand, met-enkephalin.