Example sentences for: defensin

How can you use “defensin” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Defensin α3 and TSP-1 were not pursued further.

  • Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.

  • Primer sets were designed for 6 of the 13 genes; matrix metalloproteinase-9 (MMP-9), thrombospondin-1 (TSP-1), CD24, defensin α3, lipocalin-2 (LNC2), and lactoferrrin (see Table 2).

  • To test enrichment for differentially expressed genes, we amplified the PR1 gene for the biotic stressors and SA treatment, the plant defensin gene PDF1.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast