Example sentences for: defensin

How can you use “defensin” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Primer sets were designed for 6 of the 13 genes; matrix metalloproteinase-9 (MMP-9), thrombospondin-1 (TSP-1), CD24, defensin α3, lipocalin-2 (LNC2), and lactoferrrin (see Table 2).

  • To test enrichment for differentially expressed genes, we amplified the PR1 gene for the biotic stressors and SA treatment, the plant defensin gene PDF1.

  • Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.

  • Defensin α3 and TSP-1 were not pursued further.

How many words do you know? Try our free vocabulary size test!


Search for example sentences

Loading Loading...