Example sentences for: ctagggaaggaattcgacccatgtcttcgg

How can you use “ctagggaaggaattcgacccatgtcttcgg” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The EGF-like region (amino acid residues Asp 106-His 159) of monkey proHB-EGF [ 2 ] was amplified by PCR using primers MkHB-EGF 5'CTAGGGAAGGAATTCGACCCATGTCTTCGG and MkHB-EGF 3'CACAGCCAGGATGGATCCTCAATGGTCATAGG.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast