Words similar to constructed

Example sentences for: constructed

How can you use “constructed” in a sentence? Here are some example sentences to help you improve your vocabulary:

Its full sequence is presently not known but a partial open reading frame of 268 amino acids has been constructed [ 40 ] . The near-perfect 144 amino acids repeats contain two coiled-coil domains each.
A constructed clone, pGAD424/LTBP-3 EGF#1-8, that contained calcium-binding type EGF-like modules #1-8 fused to the GAL4-activation domain (see Fig.
Enriched cDNA libraries, such as the one we have constructed, may therefore contribute to the characterization of the stress transcriptome through the construction of standardized specialized arrays.
the locomotive, a diesel-burning Class 2900 Santa Fe 4-8-4 that had been constructed in 1943 but had survived the decades most admirably and now gleamed like a Secret Service agent's lapel pin, was gaining speed swiftly, its one hundred and five tons departing another whistle-stop in another anonymous town whose inhabitants clustered where the rails seemed to converge, their fluttering hands and smiling faces congealed into a tuberous mirage that already was beginning to deliquesce, its bipedal spores gamboling away from the station where, only moments before, the candidates had stood to receive the traditional accolade from the traditional close-packed crowd.
Plasmids pB32 and pB86, carrying H109A and H109D alleles of HNT2 , were constructed by site-directed mutagenesis [ 49 ] of plasmid pB05 using primers PB3 (5'ATAATGTGTGTAGCCAAGTGGGGT) and PB4 (5'TAATGTGTGTATCCAAGTGGGGTAC).