Words similar to ccccaagcttgagtatgaacaaatttactttcttctttc

Example sentences for: ccccaagcttgagtatgaacaaatttactttcttctttc

How can you use “ccccaagcttgagtatgaacaaatttactttcttctttc” in a sentence? Here are some example sentences to help you improve your vocabulary:

To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.