Example sentences for: cccagggagtcctgggcccgga

How can you use “cccagggagtcctgggcccgga” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • 1 nucleotides 480-500) and antisense primer 5'CCCAGGGAGTCCTGGGCCCGGA3' (nucleotides 657-678).

  • PCR products were generated using the following primer set: sense primer (5'TGACATCTGAGCTCTATGAGGGT3', GenBank AF365927 nucleotides 545-567) and antisense primer 5'CCCAGGGAGTCCTGGGCCCGGA3' (nucleotides 782-803).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast