Words similar to cage
- caffeine
- caffè
- caffé
- café
- café-restaurant
- café-ringed
- café-style
- cafés
- cag
- cagatgagactgggaaaggc-
- cagcagcactgcaaagaaag-
- cagcagccgcttttatgt-
- cagccttggcagcacca
- cagctgttgaattttgaccttcttaagcttgcgggagacgtcgagtccaaccctggcccc
- cage
- cage--and
- cage-groups
- cage-lined
- cage-roller
- caged
- cages
- cagey
- cagf
- cagg
- caggagatgctgttcgtagg
- caggagcccgagagcgagga-
- caggcagaacagtatgaggaac
- cagle
- cagliari
- cagliari-
Example sentences for: cage
How can you use “cage” in a sentence? Here are some example sentences to help you improve your vocabulary:
Trials should be conducted starting with other or no opening questions, using other consumption questions such as those in AUDIT, using other screens such as TWEAK rather than CAGE, changing the sequence to CAGE or TWEAK followed by consumption questions, and checking BAC at the beginning or end of the protocol.
Interbody fusion cage provide structural support as well as restore original disc height to open the intervertebral foramen.
In his view, pachucos liked to stay in the jaula (cage, jail) so that they could “accumulate these ‘rays’ as souvenirs of their imprisonment” (1971, 142).
We previously reported [ 1 ] that Hoxc-8 transgenic mice exhibit profound defects in cartilage, particularly in the rib cage and vertebral column.
Minuses: the film's New Age spirituality, its sentimental ending, and Cage's lack of acting range.
Loading...