Words similar to cage
- caffeine
- caffè
- caffé
- café
- café-restaurant
- café-ringed
- café-style
- cafés
- cag
- cagatgagactgggaaaggc-
- cagcagcactgcaaagaaag-
- cagcagccgcttttatgt-
- cagccttggcagcacca
- cagctgttgaattttgaccttcttaagcttgcgggagacgtcgagtccaaccctggcccc
- cage
- cage--and
- cage-groups
- cage-lined
- cage-roller
- caged
- cages
- cagey
- cagf
- cagg
- caggagatgctgttcgtagg
- caggagcccgagagcgagga-
- caggcagaacagtatgaggaac
- cagle
- cagliari
- cagliari-
Example sentences for: cage
How can you use “cage” in a sentence? Here are some example sentences to help you improve your vocabulary:
Trials should be conducted starting with other or no opening questions, using other consumption questions such as those in AUDIT, using other screens such as TWEAK rather than CAGE, changing the sequence to CAGE or TWEAK followed by consumption questions, and checking BAC at the beginning or end of the protocol.
There was no significant difference ( p = 0.602 Mann-Whitney test) between the two cage groups (Fig 9).
As expected, CAGE and AUDIT performed best within the spectrum of alcohol use they were developed to explore.
Further evaluation should be performed of lower cut points for TWEAK, CAGE, and AUDIT.
Adjacent to this temple, within a cage to prevent their theft, are two images alternately described as the White Tara and the Green Tara (Buddhist deities) and as Ganga and Jamuna (Hindu deities).
Loading...