Words similar to c-myc

Example sentences for: c-myc

How can you use “c-myc” in a sentence? Here are some example sentences to help you improve your vocabulary:

This compound diminished the hepatic mRNA expression of both c-myc and p53 significantly (Fig 3).
c-myc forward 5' GTGCCACGTCTCCACACATC 3'
In contrast to its effect on JunB and mdm2 mRNA levels, RU 486 diminished the hepatic expression of c-myc and p53 mRNAs to comparable degrees (Fig 3).
The molecular mechanisms leading to breast malignancies are unclear, but many genetic abnormalities and epigenetic factors have been implicated, including changes affecting known tumor suppressor genes ( p53 , BRCA1, BRCA2 , PTEN/MMAC1/TEP1) and proto-oncogenes (neu/ErbB2/HER2 , ErbB1/EGFR , PRAD-1/cyclin D1 , Mdm2 , and c-myc) [reviewed in ref.
Although its role has remained controversial, it is involved in the increase of immediate early genes such as c-myc [ 63 ] , which is upstream of cyclin D synthesis and necessary for cell division [ 64 ] . In humans, ProTα is coded by a gene family of six members.