Words similar to c-myc

Example sentences for: c-myc

How can you use “c-myc” in a sentence? Here are some example sentences to help you improve your vocabulary:

c-myc forward 5' GTGCCACGTCTCCACACATC 3'
Decreasing Liver mRNA Levels of c-myc and p53 by RU486
Increasing amount of ~65 bp long unrelated (non specific) double stranded oligo did not have any effect on this binding activity suggesting that binding of p35 to c-myc origin region is specific.
We previously reported that enhanced liver apoptosis in response to the antihepatocarcinogen rotenone was preceded and accompanied by a marked increase in the hepatic levels of c-myc mRNA [ 10 ] , a proto-oncogene that plays a dual role in cell proliferation and apoptosis [ 24 ] . Since in our study [ 10 ] rotenone inhibited hepatocellular proliferation while enhancing apoptosis, we concluded that the increase in c-myc mRNA expression acted as a pro-apoptotic signal in the liver.
The molecular mechanisms leading to breast malignancies are unclear, but many genetic abnormalities and epigenetic factors have been implicated, including changes affecting known tumor suppressor genes ( p53 , BRCA1, BRCA2 , PTEN/MMAC1/TEP1) and proto-oncogenes (neu/ErbB2/HER2 , ErbB1/EGFR , PRAD-1/cyclin D1 , Mdm2 , and c-myc) [reviewed in ref.