Words similar to branchburg
Example sentences for: branchburg
How can you use “branchburg” in a sentence? Here are some example sentences to help you improve your vocabulary:
Plasma HIV-1 RNA was assessed by the Roche Amplicor MONITOR Ultrasensitive assay (version 1.5; lower limit of quantitation [LLOQ] 50 copies/mL and quantitation range of 50 to 75,000 copies/mL, Roche Diagnostics, Branchburg, New Jersey).
The PCR for the competitive ELISA analysis was conducted using NV-1 and NV-2 oligonucleotides specific for the Ssp I repeat as previously described by Bockarie and others [ 8 ] . Amplification was performed with an Applied Biosystems 9700 PCR thermocycler (Branchburg, NJ, USA) using 36 cycles with Amplitaq gold (Applied Biosystems Branchburg, NJ, USA) in a reaction volume of 50 μl.
Then 1 u RNase H (Roche, Branchburg, NJ) was added to the reaction followed by incubation at 37°C for 15 min.
DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.
Loading...