Example sentences for: bases

How can you use “bases” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • For each TCR (consisting of up to 600 bp upstream of an open reading frame), a word was labeled conserved if all six bases were identical in at least three of the four Saccharomyces genomes, on the basis of the CLUSTALW alignment of that TCR.

  • Lastly, NM013226 showed approximately 3 bases at the 5' (surface) end which did not affect the signal intensity significantly (Figure 1C).

  • Two sets of primers were used in all reactions to yield the amplification of an endogenous control gene (β-actin, 383 bases) and the specific target genes of interest [157 bases of MDR1 (a gift from Jian Lin, Cancer Center/Institute of Cancer Research, Golumbia University, College of Physicians and Surgeons, New York, USA), 270 bases of GSTπ, 203 bases of MRP and 139 bases of TopoIIα independently (Table 1) [ 15]].

  • For the QTL on chromosome 1, a list of 121 genes was selected, most of which are within 4 million bases (Mb) upstream or 4 Mb downstream of the peak log of odds (LOD) score (approximately 18-24 centimorgans (cM) from the centromere).

  • 2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast