Words similar to bases
Example sentences for: bases
How can you use “bases” in a sentence? Here are some example sentences to help you improve your vocabulary:
For each TCR (consisting of up to 600 bp upstream of an open reading frame), a word was labeled conserved if all six bases were identical in at least three of the four Saccharomyces genomes, on the basis of the CLUSTALW alignment of that TCR.
Lastly, NM013226 showed approximately 3 bases at the 5' (surface) end which did not affect the signal intensity significantly (Figure 1C).
Two sets of primers were used in all reactions to yield the amplification of an endogenous control gene (β-actin, 383 bases) and the specific target genes of interest [157 bases of MDR1 (a gift from Jian Lin, Cancer Center/Institute of Cancer Research, Golumbia University, College of Physicians and Surgeons, New York, USA), 270 bases of GSTπ, 203 bases of MRP and 139 bases of TopoIIα independently (Table 1) [ 15]].
For the QTL on chromosome 1, a list of 121 genes was selected, most of which are within 4 million bases (Mb) upstream or 4 Mb downstream of the peak log of odds (LOD) score (approximately 18-24 centimorgans (cM) from the centromere).
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
Loading...