Words similar to base-pair

Example sentences for: base-pair

How can you use “base-pair” in a sentence? Here are some example sentences to help you improve your vocabulary:

Included in the Ensembl transcript annotations are chromosomal mapping locations at base-pair resolution.
In addition, we identified individual base-pair differences, as well as insertions and deletions of less than 20 bp.
BAC assemblies in a single sequence contigs were evaluated for base-pair accuracy using the phrap consensus quality scores.
A 169-base-pair DNA fragment of the factor V gene that includes nucleotide 1691 was amplified utilizing the polymerase chain reaction (PCR) with the forward primer 5'CATACTACAGTGACGTGGAC3' and the reverse primer 5'GACCTAACATGTTCTAGCCAGAAG3'.
BG-1 human ovarian adenocarcinoma cells were infected with a retroviral construct composed of an antisense 900 base-pair cDNA sequence of the amino-terminal region of BRCA1 . Three experiments (two of which were from independently made supernatants) showed that infection of pLXSN (vector alone) and BRCA1 antisense retroviral constructs into BG-1 cells yielded G418-resistant colonies at similar rates (titers ranged from 0.78 to 4.2 × 10 4colony-forming units/ml).