Words similar to attractive
- atrojan
- attcgtcatatcgccatt-
- attest
- attgtctgttgtgcccagtcata
- atthe
- attica
- attracted
- attracting
- attraction
- attraction-relationship
- attractions
- attractions--as
- attractive
- attractive--since
- attractively
- attractiveness
- attracts
- attrib
- attributable
- attribute
- attributed
- attribution
- atttaggtgacactatag-
- attttgtgg
- atv
Example sentences for: attractive
How can you use “attractive” in a sentence? Here are some example sentences to help you improve your vocabulary:
This location made APBA2 an attractive positional candidate gene for involvement in duplication-associated and inherited autism.
On a train you're not trapped in your seat; you can stroll the aisles or amble to the bar car and meet an attractive stranger with whom to initiate what is certain to be a disastrous relationship.
Every company's marketing strategy has an underlying secondary message--drink Mountain Dew and you're extreme ; buy Tommy Hilfiger (Gingold's example) and you're young, attractive, and not afraid to look like every other frat boy in the country.
One of the most attractive postwar urban innovations in Japan is Sapporo’s Odori Promenade, a broad green boulevard lined with flower beds, lilacs, and maples — and with fountains down the middle, running east to west for a straight mile.
Willey is a more believable witness than Lewinsky, explain the pundits, because she's an appealing, attractive woman (John Harris, PBS's Washington Week in Review ; Evan Thomas, Inside Washington ). And Willey carries no right-wing conspirator baggage: She's a through and through Dem with impeccable left-wing credentials (Susan Page, Late Edition ; Brit Hume, Fox News Sunday ; Gigot, NewsHour ; Thomas).
Loading...