Words similar to attractive
- atrojan
- attcgtcatatcgccatt-
- attest
- attgtctgttgtgcccagtcata
- atthe
- attica
- attracted
- attracting
- attraction
- attraction-relationship
- attractions
- attractions--as
- attractive
- attractive--since
- attractively
- attractiveness
- attracts
- attrib
- attributable
- attribute
- attributed
- attribution
- atttaggtgacactatag-
- attttgtgg
- atv
Example sentences for: attractive
How can you use “attractive” in a sentence? Here are some example sentences to help you improve your vocabulary:
A little farther east is Casa Algarve, which sells pottery and handicrafts in an attractive old house.
For more sophisticated shopping, nothing can compare with Marbella or Puerto Banús, where dozens of attractive harborfront boutiques offer a stunning selection of merchandise at equally stunning prices.
To make our pages more attractive, we had been using quotation marks and apostrophes that curl left or right, as appropriate, rather than all-purpose marks that are straight vertical.
In addition, the facts that they are rapidly growing and metabolizing, were shown to produce ample quantities of subunit A transcript, and possess several organs including roots, hypocotyls, and cotyledons made them an attractive choice for analysis.
These days the town, set around an attractive curving beach, is an increasingly popular family resort.