Words similar to attgtctgttgtgcccagtcata
Example sentences for: attgtctgttgtgcccagtcata
How can you use “attgtctgttgtgcccagtcata” in a sentence? Here are some example sentences to help you improve your vocabulary:
First strand cDNA synthesis was performed at 42°C for 30 min in a 20 μl reaction containing: 5 μg RNA, 500 nM NEO A primer (5'-ATTGTCTGTTGTGCCCAGTCATA), 20 mM Tris-HCl (pH 8.4), 50 mM KCl 2.5 mM MgCl 2 , 10 mM DTT, 400 μM each dNTP, and 8 units Super Script II reverse transcriptase (Gibco-BRL).
Loading...