Words similar to atcc
- atavistic
- ataw
- ataxia
- ataxia-oculomotor
- ataxin-
- atc
- atcaa
- atcagcggccgcgatcc-
- atcatctgtggctcagagtcg
- atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag
- atcc
- atcc-
- atcc-na
- atccatgccatccacgtcaag
- atccgtaccagtggctaaaagg
- atcctaa
- atcgaactggtgtgtcgaagg
- atctcgaaggagattgttatagg-
- ate
- ate s
- atelectasis
Example sentences for: atcc
How can you use “atcc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The expression pattern of the DLG5 gene was analyzed in multiple adult human tissues by Northern Blot Analysis using as a probe the ATCC clone #409942 (EST ym59b11) with insert an size of 2.386 Kb which contains exon 31 and 32 with 3' untranslated region of the gene.
F98 rat glioma cells (ATCC, http://www.atcc.org/, Manassas, VA) were also used for comparative purposes in this study, and were cultured as described for SH-SY5Y cells.
Human tumor cell lines - LS1034 colorectal carcinoma (ATCC Number: CRL-2158), SW480 colorectal adenocarcinoma (ATCC Number: CCL-228), MSTO-211H biphasic mesothelioma (ATCC Number: CRL-2081) and HepG2 hepatocellular carcinoma (ATCC Number: HB-8065) - were purchased from American Type Culture Collection.
LNCaP-FGC cells were obtained from ATCC (order number CRL-10995) and maintained in RPMI supplemented with 10% FBS as described [ 46 ] . We noticed that LNCaP cells at low density grow best on 15 cm Falcon 3025 tissue culture dishes and that the effects of SKP2 overexpression were most pronounced when cells were cultured on these dishes (data not shown).
Caco-2 cells (HTB 37, ATCC, Rockville, MD) were propagated and maintained as described previously [ 17 ] . Caco-2 cells were studied between passages 30-40.