Words similar to atcc
- atavistic
- ataw
- ataxia
- ataxia-oculomotor
- ataxin-
- atc
- atcaa
- atcagcggccgcgatcc-
- atcatctgtggctcagagtcg
- atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag
- atcc
- atcc-
- atcc-na
- atccatgccatccacgtcaag
- atccgtaccagtggctaaaagg
- atcctaa
- atcgaactggtgtgtcgaagg
- atctcgaaggagattgttatagg-
- ate
- ate s
- atelectasis
Example sentences for: atcc
How can you use “atcc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The Acinetobacter baumannii ATCC 19606 strain was procured from American Type Cell Culture, USA.
The SWY2324, SWY2325, SWY2332, and SWY2333 strains were transformed with a LEU2/CEN yeast genomic library (ATCC, Manassas, VA).
Caco-2 cells (HTB 37, ATCC, Rockville, MD) were propagated and maintained as described previously [ 17 ] . Caco-2 cells were studied between passages 30-40.
All infections were performed on subconfluent cells that were passaged between 7 and 10 times after arrival from ATCC (original stock was p18).
All cells were obtained from from ATCC and maintained in DMEM supplemented with 17% fetal calf serum.
Loading...