Words similar to atcc
- atavistic
- ataw
- ataxia
- ataxia-oculomotor
- ataxin-
- atc
- atcaa
- atcagcggccgcgatcc-
- atcatctgtggctcagagtcg
- atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag
- atcc
- atcc-
- atcc-na
- atccatgccatccacgtcaag
- atccgtaccagtggctaaaagg
- atcctaa
- atcgaactggtgtgtcgaagg
- atctcgaaggagattgttatagg-
- ate
- ate s
- atelectasis
Example sentences for: atcc
How can you use “atcc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The CD3 plasmid was commercially obtained from the American Type Culture Collection (ATCC, Manassas, VA) and the respective cDNA insert was generated by a Pst I digestion.
The human alveolar epithelial cell line A549 (ATCC, Rockville, MD, USA) was grown in RPMI plus 10% fetal bovine serum, 100 U/ml penicillin, 100 U/ml streptomycin, and 250 ng/ml amphotericin-B in an atmosphere of 5% carbon dioxide and 95% air at 37°C.
SB5 (ATCC; VR-2546) was plaque-purified from HSV-2 333 kindly provided by Dr. Priscilla Schaffer (University of Pennsylvania, PA) at passage 6.
MDCK cells obtained from ATCC were cultured in DMEM containing 10% FBS, 100 U/ml penicillin, 100 μg/ml streptomycin, 0.292 mg/ml glutamine (growth medium) in 5% CO 2 at 37°C.
Human prostate carcinoma cells, LNCaP (ATCC, Rockville, MD), were maintained and propagated in T25 flasks in RPMI 1640 media (GIBCO-BRL, Gaithersburg, MD) supplemented with 10% FCS (Gemini Bio-Products, Calabasas, CA), 2 mM glutamine, Fungizone (1 μg/ml) and penicillin (200 unit/ml)/ streptomycin (200 μg/ml) (referred as complete medium) in a 37°C humidified 5% CO 2 incubator.
Loading...