Words similar to atcc
- atavistic
- ataw
- ataxia
- ataxia-oculomotor
- ataxin-
- atc
- atcaa
- atcagcggccgcgatcc-
- atcatctgtggctcagagtcg
- atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag
- atcc
- atcc-
- atcc-na
- atccatgccatccacgtcaag
- atccgtaccagtggctaaaagg
- atcctaa
- atcgaactggtgtgtcgaagg
- atctcgaaggagattgttatagg-
- ate
- ate s
- atelectasis
Example sentences for: atcc
How can you use “atcc” in a sentence? Here are some example sentences to help you improve your vocabulary:
A weakly immunogenic lung cancer, Lewis lung carcinoma (3LL, H-2 b) obtained from ATCC (CRL-1642, LLC) was utilized for assessment of cytokines important for SLC/CCL21 - mediated anti-tumor responses in vivo . The cells were routinely cultured as monolayers in 25 cm 3tissue culture flasks containing RPMI 1640 medium (Irvine Scientific, Santa Anna, CA) supplemented with 10% fetal bovine serum (FBS) (Gemini Bioproducts, Calabasas, CA), penicillin (100 U/ml), streptomycin (0.
Vero (ATCC, passage 15-20), MRC-5 (ATCC, passage 12-15) and PolB3 (kind gift of D. Coen, Harvard University, Boston MA) cell lines were grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS) and incubated at 37°C, 5%CO 2 . PolB3 represents a Vero cell line constitutively expressing the HSV-1 Pol [ 17 ] . PCV was synthesized at SmithKline Beecham Pharmaceuticals.
A FLAG-tagged DEK adenoviral vector constructed by the University of Michigan Vector Core was used to transduce T98G cells (ATCC) by incubation for 48 hours before harvesting for immunoprecipitation.
All cells were obtained from from ATCC and maintained in DMEM supplemented with 17% fetal calf serum.
The Acinetobacter baumannii ATCC 19606 strain was procured from American Type Cell Culture, USA.
Loading...