Words similar to atcc
- atavistic
- ataw
- ataxia
- ataxia-oculomotor
- ataxin-
- atc
- atcaa
- atcagcggccgcgatcc-
- atcatctgtggctcagagtcg
- atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag
- atcc
- atcc-
- atcc-na
- atccatgccatccacgtcaag
- atccgtaccagtggctaaaagg
- atcctaa
- atcgaactggtgtgtcgaagg
- atctcgaaggagattgttatagg-
- ate
- ate s
- atelectasis
Example sentences for: atcc
How can you use “atcc” in a sentence? Here are some example sentences to help you improve your vocabulary:
Strain 144M, a serum-sensitive mucoid isolate from a CF patient, contains short O-side chain LPS, while its serum-resistant derivative, 144M(SR), which is also mucoid, has long O-side chain LPS [ 33 ] . Strain FRD-1 is a mucoid CF isolate [ 34 ] and FRD-2 is its spontaneous nonmucoid derivative [ 35 ] . P. aeruginosa ATCC strains 10145 and 9027 are nonmucoid strains with long O-side chain LPSs [N L Schiller, unpublished results].
F98 rat glioma cells (ATCC, http://www.atcc.org/, Manassas, VA) were also used for comparative purposes in this study, and were cultured as described for SH-SY5Y cells.
All infections were performed on subconfluent cells that were passaged between 7 and 10 times after arrival from ATCC (original stock was p18).
B. cepacia ATCC strains 25416 and 25609, as well as three clinical strains isolated from patients with CF in Vancouver, Canada, kindly provided by David P Speert, University of British Columbia.
The CD3 plasmid was commercially obtained from the American Type Culture Collection (ATCC, Manassas, VA) and the respective cDNA insert was generated by a Pst I digestion.
Loading...