Words similar to atcc
- atavistic
- ataw
- ataxia
- ataxia-oculomotor
- ataxin-
- atc
- atcaa
- atcagcggccgcgatcc-
- atcatctgtggctcagagtcg
- atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag
- atcc
- atcc-
- atcc-na
- atccatgccatccacgtcaag
- atccgtaccagtggctaaaagg
- atcctaa
- atcgaactggtgtgtcgaagg
- atctcgaaggagattgttatagg-
- ate
- ate s
- atelectasis
Example sentences for: atcc
How can you use “atcc” in a sentence? Here are some example sentences to help you improve your vocabulary:
A549 is an undifferentiated lung carcinoma and was purchased from American Type Culture Collection (ATCC, Rockville, MD).
F98 rat glioma cells (ATCC, http://www.atcc.org/, Manassas, VA) were also used for comparative purposes in this study, and were cultured as described for SH-SY5Y cells.
The SWY2324, SWY2325, SWY2332, and SWY2333 strains were transformed with a LEU2/CEN yeast genomic library (ATCC, Manassas, VA).
The human alveolar epithelial cell line A549 (ATCC, Rockville, MD, USA) was grown in RPMI plus 10% fetal bovine serum, 100 U/ml penicillin, 100 U/ml streptomycin, and 250 ng/ml amphotericin-B in an atmosphere of 5% carbon dioxide and 95% air at 37°C.
7 mouse macrophage cell line was obtained from ATCC (Manassas, USA) and grown in a humidified 5% CO
Loading...