Words similar to atcc
- atavistic
- ataw
- ataxia
- ataxia-oculomotor
- ataxin-
- atc
- atcaa
- atcagcggccgcgatcc-
- atcatctgtggctcagagtcg
- atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag
- atcc
- atcc-
- atcc-na
- atccatgccatccacgtcaag
- atccgtaccagtggctaaaagg
- atcctaa
- atcgaactggtgtgtcgaagg
- atctcgaaggagattgttatagg-
- ate
- ate s
- atelectasis
Example sentences for: atcc
How can you use “atcc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The LNCaP cell line was obtained from the ATCC and maintained in RPMI media with 10% FBS and penicillin/streptomycin.
SiHa cells which contain 1-2 copies of HPV 16 integrated at chromosome 13q21-31, HeLa cells which contain up to 50 copies of HPV 18 integrated at 5 sites and CaSki cells which contain up to 600 copies of HPV 16 integrated at multiple sites [ 1 ] were obtained from the ATCC, Manassas, VA.
ERK was found to be constitutively phosphorylated in our study using MDCK cells from ATCC, in contrast to what has been reported previously for MDCK-D 1 , a subclone of MDCK selected for adrenergic receptor expression [ 39 40 ] . However, a side-by-side comparison of MDCK cells from ATCC and the MDCK-D 1 subclone (kindly provided by Dr. Paul Insel, UCSD) demonstrated constitutive activation of ERKs when both are grown at low density (not shown).
These include Serratia marcescens, Serratia rubidae, Enterobacter agglomerans (ATCC 27155), Erwinia herbicola, E. milletiae, E. ananas, E. tracheiphila, E. chrysanthemi and E. amylovora.
A FLAG-tagged DEK adenoviral vector constructed by the University of Michigan Vector Core was used to transduce T98G cells (ATCC) by incubation for 48 hours before harvesting for immunoprecipitation.
Loading...