Words similar to antisense
Example sentences for: antisense
How can you use “antisense” in a sentence? Here are some example sentences to help you improve your vocabulary:
For example, it was shown recently that the reduction of PTEN expression levels by antisense oligonucleotides in a colon carcinoma cell line generated differential effects on cell adhesion, depending on whether the cells were kept under static or hydrodynamic conditions of fluid flow [ 47 ] .
ORF1L and ORF2S are present in the antisense orientation and their sense probes hybridize with PEVE ss-DNA stretches.
Similarly, despite much initial enthusiasm, attempts to develop antisense drugs have been largely disappointing.
At least that was the theory, and early clinical results seemed to support the theory: antisense drugs effectively reduced tumor sizes in anticancer trials and viral loads in antiviral trials.
In a seperate reaction, sense primer 5'GGAGAAGTCTGTGATCGCCAAGAAGCTGGA3' was paired with antisense primer (nt 3100 to nt 3081).