Words similar to antisense

Example sentences for: antisense

How can you use “antisense” in a sentence? Here are some example sentences to help you improve your vocabulary:

2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
Given the fact that the transfection efficiency obtained in these experiments was approximately 30% (as determined with fluorescent dye-labeled oligonucleotides; data not shown), the results indicate that, in cells that had taken up the antisense oligomer, the inhibition of PLD2 expression was complete.
BRCA1 antisense infected cells contained significantly less BRCA1 message than control LXSN infected cells, whether cultured in the presence or absence of estrogen (Fig.
Noting that the sense transcript encoded a potential tumor suppressor, we checked the annotated tissue origin of these ESTs, and found that a significantly greater fraction of the antisense ESTs (34/46 = ~0.
LW and QJL initials carried out the TN antisense studies.