Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
To investigate the protection cytotoxic effects of oxidants (DPPH, H 2 O 2 , and ONOO -), cells (AGS and IEC-18) were seeded in 96-well plates (1.
Cells, AGS or IEC-18, were seeded in 96-well plates (1.
The degree of cellular necrosis (cell membrane integrity) in AGS and IEC-18 cells was determined by measuring the level of lactate dehydrogenase (LDH) released into culture media.
Using the release of BrdU-labeled DNA assay for early stage necrosis, it was noted that hydrogen peroxide (50 μM) increased necrosis in AGS cells by approximately 34% (Figure 5).
But somehow, more federal activism has only spurred the litigious exuberance of the 50 AGs.