Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
At the concentrations studied, addition of antioxidants to either AGS (Figure 1) or IEC-18 cells (Figure 2) failed to affect cell proliferation over 72 hours.
In both AGS and IEC-18 cells, DPPH (3 μM) produced a 20-30% reduction in cell viability (Table 2, 3and 4).
Cells, AGS or IEC-18, were seeded in 96-well plates (1.
Using the media release of BrdU-labeled DNA as an index of early necrotic cell death, it was observed that peroxynitrite treatment induced necrosis in AGS cells (P < 0.001).
AGS are a transformed cell line, consequently, one could argue that dietary antioxidants could prevent the elimination of these transformed cells by the mucosal immune response.
Loading...