Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
At the concentrations studied, addition of antioxidants to either AGS (Figure 1) or IEC-18 cells (Figure 2) failed to affect cell proliferation over 72 hours.
In contrast, the MTT assay did not reveal changes in cell number in response to hydrogen peroxide in either AGS or IEC-18 cells (Tables 2and 3).
Using the release of BrdU-labeled DNA assay for early stage necrosis, it was noted that hydrogen peroxide (50 μM) increased necrosis in AGS cells by approximately 34% (Figure 5).
Ascorbic acid treatment was less effective than either green tea or cat's claw in attenuating hydrogen peroxide-induced apoptosis in AGS cells (P < 0.01).
Apoptosis was induced in both AGS and IEC-18 cells by peroxynitrite (P < 0.001), quantified by ELISA and confirmed morphologically by acridine orange.
Loading...