Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
Using the media release of BrdU-labeled DNA as an index of early necrotic cell death, it was observed that peroxynitrite treatment induced necrosis in AGS cells (P < 0.001).
AGS are a transformed cell line, consequently, one could argue that dietary antioxidants could prevent the elimination of these transformed cells by the mucosal immune response.
Ascorbic acid treatment was less effective than either green tea or cat's claw in attenuating hydrogen peroxide-induced apoptosis in AGS cells (P < 0.01).
Cells (AGS or IEC-18) were seeded into 96-well plates (1.
Using media release of BrdU-labeled DNA fragments as an index of early stage necrosis, it was noted that DPPH (3 μM) did not raise rates of necrosis above that evident in untreated control AGS cells (Table 4).
Loading...