Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
In AGS cells, ascorbic acid caused a reduction in the apoptotic response to peroxynitrite (P < 0.01).
Using the release of BrdU-labeled DNA assay for early stage necrosis, it was noted that hydrogen peroxide (50 μM) increased necrosis in AGS cells by approximately 34% (Figure 5).
The induction or necrosis by H 2 O 2 in AGS cells was prevented by cat's claw, green tea and ascorbic acid (P < 0.01).
Now all AGs want to be the next Michael Moore.
DPPH had no effect on media LDH levels in AGS cells but significantly raised levels in IEC-18 cells (Table 4).
Loading...