Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
c 1000 Ags.
Cells (AGS or IEC-18) were seeded into 96-well plates (1.
In both AGS and IEC-18 cells, DPPH (3 μM) produced a 20-30% reduction in cell viability (Table 2, 3and 4).
Using media release of BrdU-labeled DNA fragments as an index of early stage necrosis, it was noted that DPPH (3 μM) did not raise rates of necrosis above that evident in untreated control AGS cells (Table 4).
But somehow, more federal activism has only spurred the litigious exuberance of the 50 AGs.
Loading...