Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
Of course, Morales was merely explicit where other AGs prefer to be coy.
At the concentrations studied, addition of antioxidants to either AGS (Figure 1) or IEC-18 cells (Figure 2) failed to affect cell proliferation over 72 hours.
To investigate the protection cytotoxic effects of oxidants (DPPH, H 2 O 2 , and ONOO -), cells (AGS and IEC-18) were seeded in 96-well plates (1.
The degree of cellular necrosis (cell membrane integrity) in AGS and IEC-18 cells was determined by measuring the level of lactate dehydrogenase (LDH) released into culture media.
Using the release of BrdU-labeled DNA assay for early stage necrosis, it was noted that hydrogen peroxide (50 μM) increased necrosis in AGS cells by approximately 34% (Figure 5).
Loading...