Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
Using the release of BrdU-labeled DNA assay for early stage necrosis, it was noted that hydrogen peroxide (50 μM) increased necrosis in AGS cells by approximately 34% (Figure 5).
This response was attenuated by the antioxidants in the following order of potency green tea > cat's claw > ascorbic acid for AGS cells (Figure 3).
But somehow, more federal activism has only spurred the litigious exuberance of the 50 AGs.
Ascorbate would remain more effective, rather than being the weakest of the antioxidants studied to limit apoptosis (in AGS cells).
Of course, Morales was merely explicit where other AGs prefer to be coy.
Loading...