Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
In both AGS and IEC-18 cells, DPPH (3 μM) produced a 20-30% reduction in cell viability (Table 2, 3and 4).
But somehow, more federal activism has only spurred the litigious exuberance of the 50 AGs.
To investigate the protection cytotoxic effects of oxidants (DPPH, H 2 O 2 , and ONOO -), cells (AGS and IEC-18) were seeded in 96-well plates (1.
In AGS cells, ascorbic acid caused a reduction in the apoptotic response to peroxynitrite (P < 0.01).
Using the media release of BrdU-labeled DNA as an index of early necrotic cell death, it was observed that peroxynitrite treatment induced necrosis in AGS cells (P < 0.001).
Loading...