Example sentences for: acidophilum

How can you use “acidophilum” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Despite the chemical and physical differences between the E. coli cytoplasm and the environment in which the T. acidophilum intein is functioning in vivo, we found no indications that self-splicing of the intein was inefficient in E. coli.

  • The T. acidophilum intein was discovered while sequencing the catalytic subunit of the archaeal ATPase/ATPsynthase from T. acidophilum for systematic purposes [ 24 ] . More recently, the complete genome sequences of T. acidophilum [ 25 ] and T. volcanii [ 26 ] have been reported.

  • The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).

  • The T. acidophilum A-ATPase A subunit has 763 codons.

  • The other two major differences in codon usage between the T. acidophilum A-ATPase A subunit and E. coli are AGG (Arg) and AGA (Arg) which are present in T. acidophilum A-ATPase A subunit at frequencies of 41 and 16 per 1000 respectively.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast