Example sentences for: acidophilum

How can you use “acidophilum” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Despite the chemical and physical differences between the E. coli cytoplasm and the environment in which the T. acidophilum intein is functioning in vivo, we found no indications that self-splicing of the intein was inefficient in E. coli.

  • This activity does not depend on the physicochemical conditions in the T. acidophilum cytoplasm.

  • In contrast, the T. acidophilum subunit is expressed as a soluble protein in the E. coli cytoplasm.

  • The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).

  • The gene encoding the T. acidophilum A-ATPase A subunit was cloned into the expression vector pET-11a (Stratagene) and transformed into E. coli Bl21(DE3) and E. coli Bl21-CodonPlus(DE3)-RIL strain for protein expression.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast