Words similar to acidophilum

Example sentences for: acidophilum

How can you use “acidophilum” in a sentence? Here are some example sentences to help you improve your vocabulary:

These primers match the coding sequence of the Thermoplasma acidophilum A-ATPase A subunit (gene identification number 9369337) and introduce restriction sites useful in subcloning.
The T. acidophilum A-ATPase intein appears to splice out efficiently at very different pHs (7.
The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).
The T. acidophilum intein retains efficient self-splicing activity when expressed in E. coli.
The significance of the match between the T. acidophilum and the three pyrococcal ATPase inteins was assessed using PRSS at http://fasta.bioch.virginia.edu/fasta/prss.htm [ 29 ] . The P-value for this match, i.e. the probability of obtaining a match of this quality by chance alone, was calculated to be below 10 -10.