Words similar to acidophilum

Example sentences for: acidophilum

How can you use “acidophilum” in a sentence? Here are some example sentences to help you improve your vocabulary:

Despite the chemical and physical differences between the E. coli cytoplasm and the environment in which the T. acidophilum intein is functioning in vivo, we found no indications that self-splicing of the intein was inefficient in E. coli.
This activity does not depend on the physicochemical conditions in the T. acidophilum cytoplasm.
In contrast, the T. acidophilum subunit is expressed as a soluble protein in the E. coli cytoplasm.
The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).
The gene encoding the T. acidophilum A-ATPase A subunit was cloned into the expression vector pET-11a (Stratagene) and transformed into E. coli Bl21(DE3) and E. coli Bl21-CodonPlus(DE3)-RIL strain for protein expression.