Example sentences for: accuzyme

How can you use “accuzyme” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • prad26reverse : GATGTGGGTGCGGGACGGGAAAGAACAACACTGAAGAAACAAGTATCATTATTTCATTTGAAAAATTAGGGAAATGAATTCGAGCTCGTTTAAAC) were used to amplify the GFP (S65T)-kanMX6 module of pFA6a-GFP (S65T)-kanMX6 [ 41 ] in ten separate 50 μl PCR reactions using Accuzyme, high-fidelity polymerase (Bioline, Randolph, MA).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast