Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The cDNA generated had an overlap of 305 bp with the published DLG5 cDNA (Genbank Acc.
In the liver, intestine, adipose, and mammary gland, the cytoplasmic form synthesizes acetyl CoA for lipogenesis [ 46 ] . It is regulated by SREBP-1a, -1c- and -2, as well as SP1 and SP3 binding to GC-boxes; the promoter also contains an E-box [ 47 ] . It is down regulated with fasting, and induced with re-feeding; such dietary regulation does not exist in SREBP-1 knockout mice [ 48 ] . More generally, acyl CoA synthase is reported to be PPARα-activated [ 49 ] . The observed down regulation is consistent with less acetyl CoA available for the ACC reaction, as well as a plethora of other reactions.
Using Search Launcher available on the Molecular Biology Computational Resources (MBCR) server at Baylor College of Medicine (BCM) www.mbcr.bcm.tmc.eduhomology searches on the new cDNA sequence against DBEST database identified several ESTs, {Acc.
Other examples of consistency between our microarray results on receptors and the HIV-1 Tat literature, include the down-regulation of gene expression in uPAR (Acc# X74039), IP3 (Acc# D26070, D26351), Glu R flop (Acc# U10302), PPAR (Acc# L07592), alpha-2 macroglobulin receptor protein (Acc# M63959), and receptor tyrosine kinase (Acc# L36645, U66406) genes.
Homologous sequences were identified on BAC 651 c23 (Acc.