Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
For instance, mRNA for the neuropeptide Y-like receptor (Acc# X71635), which was up-regulated in Tat expressing cells, was initially discovered as a G-protein coupled neuropeptide Y receptor, and later found to be homologous to the co-receptor CCR5 needed for HIV-1 infection of monocyte/macrophage cells.
In the liver, intestine, adipose, and mammary gland, the cytoplasmic form synthesizes acetyl CoA for lipogenesis [ 46 ] . It is regulated by SREBP-1a, -1c- and -2, as well as SP1 and SP3 binding to GC-boxes; the promoter also contains an E-box [ 47 ] . It is down regulated with fasting, and induced with re-feeding; such dietary regulation does not exist in SREBP-1 knockout mice [ 48 ] . More generally, acyl CoA synthase is reported to be PPARα-activated [ 49 ] . The observed down regulation is consistent with less acetyl CoA available for the ACC reaction, as well as a plethora of other reactions.
#BF357671 and Acc.
Although ACC was not regulated at the transcriptional level, cytoplasmic citrate (generated from the Acly reaction) is an allosteric activator of ACC, so less cytoplasmic citrate would lead to less activation of ACC [ 45 ] . Transcript levels of hepatic acetyl CoA synthetase 1 AMP forming (acetate:CoA ligase AMP forming; Acas1) were consistently down regulated by LC-PUFA (-2.
Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.
Loading...