Example sentences for: acc

How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.

  • The malonyl CoA generated in the ACC reaction then inhibits FA oxidation by reversibly inhibiting Cpt1.

  • Other examples of consistency between our microarray results on receptors and the HIV-1 Tat literature, include the down-regulation of gene expression in uPAR (Acc# X74039), IP3 (Acc# D26070, D26351), Glu R flop (Acc# U10302), PPAR (Acc# L07592), alpha-2 macroglobulin receptor protein (Acc# M63959), and receptor tyrosine kinase (Acc# L36645, U66406) genes.

  • Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.

  • ACC acetyl CoA carboxylase


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast