Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
ACC acetyl CoA carboxylase
#BF357671 and Acc.
Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.
It is interesting to note that Cdc2 (Acc# X05360), Cdc10 homolog (Acc# S72008), and Cdc37 (Acc# U43077) were all up-regulated in Tat expressing cells.
Strain K84 biological control is primarily due to production of two plasmid-encoded antibiotics, agrocins 84 and 484, encoded by genes on pAgK84 and pAgK434 respectively [ 5 ] . Agrocin 84, an adenosine analog [ 6 ] , is effective against tumorigenic strains carrying nopaline/agrocinopine tumor-inducing plasmids, and requires the acc system in the target strain for activity [ 7 ] . Agrocin 434, a di-substituted cytidine analog, is effective against, and specific for, a broad range of A. rhizogenes strains [ 8 ] . Curing of either agrocin-encoding plasmid results in reduction of biological control activity [ 9 ] . Thus, K84 demonstrates the efficacy of antibiosis for crown gall biological control.
Loading...