Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The Tnfrh1 cDNA probes (the longer probe made using primers 1 and 2, and matching the first 506 nt of Genbank Acc.
Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
Strain K84 biological control is primarily due to production of two plasmid-encoded antibiotics, agrocins 84 and 484, encoded by genes on pAgK84 and pAgK434 respectively [ 5 ] . Agrocin 84, an adenosine analog [ 6 ] , is effective against tumorigenic strains carrying nopaline/agrocinopine tumor-inducing plasmids, and requires the acc system in the target strain for activity [ 7 ] . Agrocin 434, a di-substituted cytidine analog, is effective against, and specific for, a broad range of A. rhizogenes strains [ 8 ] . Curing of either agrocin-encoding plasmid results in reduction of biological control activity [ 9 ] . Thus, K84 demonstrates the efficacy of antibiosis for crown gall biological control.
In the liver, intestine, adipose, and mammary gland, the cytoplasmic form synthesizes acetyl CoA for lipogenesis [ 46 ] . It is regulated by SREBP-1a, -1c- and -2, as well as SP1 and SP3 binding to GC-boxes; the promoter also contains an E-box [ 47 ] . It is down regulated with fasting, and induced with re-feeding; such dietary regulation does not exist in SREBP-1 knockout mice [ 48 ] . More generally, acyl CoA synthase is reported to be PPARα-activated [ 49 ] . The observed down regulation is consistent with less acetyl CoA available for the ACC reaction, as well as a plethora of other reactions.
The primers for rat TNF-α, were designed using the DNASTAR Lasergene software (Madison, WI) and the rat TNF-α cDNA sequence (GenBank accession number NM 012675), and are sense (bp 127 - 150):5'-GGG GCC ACC ACG CTC TTC TGT CTA-3' and antisense (bp 285 - 307): 5'-CCT CCG CTT GGT TTG CTA CG-3', and generate a 181 bp cDNA product.
Loading...