Example sentences for: acc

How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • For instance, mRNA for the neuropeptide Y-like receptor (Acc# X71635), which was up-regulated in Tat expressing cells, was initially discovered as a G-protein coupled neuropeptide Y receptor, and later found to be homologous to the co-receptor CCR5 needed for HIV-1 infection of monocyte/macrophage cells.

  • Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.

  • The Acly reaction enhances FA synthesis by providing more acetyl CoA and NADPH substrates and enhancing ACC activity.

  • ACC acetyl CoA carboxylase

  • Strain K84 biological control is primarily due to production of two plasmid-encoded antibiotics, agrocins 84 and 484, encoded by genes on pAgK84 and pAgK434 respectively [ 5 ] . Agrocin 84, an adenosine analog [ 6 ] , is effective against tumorigenic strains carrying nopaline/agrocinopine tumor-inducing plasmids, and requires the acc system in the target strain for activity [ 7 ] . Agrocin 434, a di-substituted cytidine analog, is effective against, and specific for, a broad range of A. rhizogenes strains [ 8 ] . Curing of either agrocin-encoding plasmid results in reduction of biological control activity [ 9 ] . Thus, K84 demonstrates the efficacy of antibiosis for crown gall biological control.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast