Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The introns were PCR-amplified with KM37 (GAT AAT ACG ACT CAC TAT AAT GGC ATT ACC GCC TTG T) and GM24 (GCT CTA GAC TTA GCT ACA ATA TGA AC) in 25 μl reactions under the conditions stated above and cycled 20 times.
Although ACC was not regulated at the transcriptional level, cytoplasmic citrate (generated from the Acly reaction) is an allosteric activator of ACC, so less cytoplasmic citrate would lead to less activation of ACC [ 45 ] . Transcript levels of hepatic acetyl CoA synthetase 1 AMP forming (acetate:CoA ligase AMP forming; Acas1) were consistently down regulated by LC-PUFA (-2.
AC013252) and BAC 126h7 (Acc.
It is interesting to note that Cdc2 (Acc# X05360), Cdc10 homolog (Acc# S72008), and Cdc37 (Acc# U43077) were all up-regulated in Tat expressing cells.
The cDNA generated had an overlap of 305 bp with the published DLG5 cDNA (Genbank Acc.
Loading...