Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
Structure-function analysis of the NCoAs have revealed multiple copies of a signature motif, LXXLL, with conserved spacing that is required for interaction with nuclear receptors and CBP/p300 [ 99 101 ] . Intriguingly, different LXXLL motifs are required for PPARγ (Peroxisome Proliferator activated receptor γ, a gene down-regulated in Tat expressing cells; Acc# L07592, Table 1) function in response to different classes of ligands, suggesting distinct configuration of assembled complexes.
Using Search Launcher available on the Molecular Biology Computational Resources (MBCR) server at Baylor College of Medicine (BCM) www.mbcr.bcm.tmc.eduhomology searches on the new cDNA sequence against DBEST database identified several ESTs, {Acc.
The introns were PCR-amplified with KM37 (GAT AAT ACG ACT CAC TAT AAT GGC ATT ACC GCC TTG T) and GM24 (GCT CTA GAC TTA GCT ACA ATA TGA AC) in 25 μl reactions under the conditions stated above and cycled 20 times.
For instance, mRNA for the neuropeptide Y-like receptor (Acc# X71635), which was up-regulated in Tat expressing cells, was initially discovered as a G-protein coupled neuropeptide Y receptor, and later found to be homologous to the co-receptor CCR5 needed for HIV-1 infection of monocyte/macrophage cells.
Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.