Example sentences for: acc

How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.

  • The cDNA generated had an overlap of 305 bp with the published DLG5 cDNA (Genbank Acc.

  • Another example of co-receptors with multiple functions is the leukotriene family member B4, which was down-regulated in Tat expressing cells (Acc# D89078, Table 1).

  • #BF357671 and Acc.

  • Strain K84 biological control is primarily due to production of two plasmid-encoded antibiotics, agrocins 84 and 484, encoded by genes on pAgK84 and pAgK434 respectively [ 5 ] . Agrocin 84, an adenosine analog [ 6 ] , is effective against tumorigenic strains carrying nopaline/agrocinopine tumor-inducing plasmids, and requires the acc system in the target strain for activity [ 7 ] . Agrocin 434, a di-substituted cytidine analog, is effective against, and specific for, a broad range of A. rhizogenes strains [ 8 ] . Curing of either agrocin-encoding plasmid results in reduction of biological control activity [ 9 ] . Thus, K84 demonstrates the efficacy of antibiosis for crown gall biological control.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast