Example sentences for: acc

How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • ACC acetyl CoA carboxylase

  • The AtMAF1 open reading frame was isolated by PCR from Arabidopis genomic DNA using the 5' primer 5'-TCC ATG GCC GAA ACC GAA-3' and the 3' primer 5'-CTA AGT TCA CTT CGA ACT GCT C-3', which had been designed to match the Arabidopsis MAF1 homolog on the P1 clone MGG4 of chromosome 5 (GenBank accession number AB008267).

  • The primers were based on RSV ( Acc# M74568) and actin (X00351) sequences, and are as follows (sense and antisense, respectively):

  • Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.

  • Homologous sequences were identified on BAC 651 c23 (Acc.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast