Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
As described above, Acly expression (and possibly ACC activity) was significantly down regulated by LC-PUFAs, likely leading to less FA synthesis.
Another example of co-receptors with multiple functions is the leukotriene family member B4, which was down-regulated in Tat expressing cells (Acc# D89078, Table 1).
Structure-function analysis of the NCoAs have revealed multiple copies of a signature motif, LXXLL, with conserved spacing that is required for interaction with nuclear receptors and CBP/p300 [ 99 101 ] . Intriguingly, different LXXLL motifs are required for PPARγ (Peroxisome Proliferator activated receptor γ, a gene down-regulated in Tat expressing cells; Acc# L07592, Table 1) function in response to different classes of ligands, suggesting distinct configuration of assembled complexes.
Using Search Launcher available on the Molecular Biology Computational Resources (MBCR) server at Baylor College of Medicine (BCM) www.mbcr.bcm.tmc.eduhomology searches on the new cDNA sequence against DBEST database identified several ESTs, {Acc.
Although ACC was not regulated at the transcriptional level, cytoplasmic citrate (generated from the Acly reaction) is an allosteric activator of ACC, so less cytoplasmic citrate would lead to less activation of ACC [ 45 ] . Transcript levels of hepatic acetyl CoA synthetase 1 AMP forming (acetate:CoA ligase AMP forming; Acas1) were consistently down regulated by LC-PUFA (-2.
Loading...