Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
In the liver, intestine, adipose, and mammary gland, the cytoplasmic form synthesizes acetyl CoA for lipogenesis [ 46 ] . It is regulated by SREBP-1a, -1c- and -2, as well as SP1 and SP3 binding to GC-boxes; the promoter also contains an E-box [ 47 ] . It is down regulated with fasting, and induced with re-feeding; such dietary regulation does not exist in SREBP-1 knockout mice [ 48 ] . More generally, acyl CoA synthase is reported to be PPARα-activated [ 49 ] . The observed down regulation is consistent with less acetyl CoA available for the ACC reaction, as well as a plethora of other reactions.
Homologous sequences were identified on BAC 651 c23 (Acc.
Although ACC was not regulated at the transcriptional level, cytoplasmic citrate (generated from the Acly reaction) is an allosteric activator of ACC, so less cytoplasmic citrate would lead to less activation of ACC [ 45 ] . Transcript levels of hepatic acetyl CoA synthetase 1 AMP forming (acetate:CoA ligase AMP forming; Acas1) were consistently down regulated by LC-PUFA (-2.
Other examples of consistency between our microarray results on receptors and the HIV-1 Tat literature, include the down-regulation of gene expression in uPAR (Acc# X74039), IP3 (Acc# D26070, D26351), Glu R flop (Acc# U10302), PPAR (Acc# L07592), alpha-2 macroglobulin receptor protein (Acc# M63959), and receptor tyrosine kinase (Acc# L36645, U66406) genes.
For instance, mRNA for the neuropeptide Y-like receptor (Acc# X71635), which was up-regulated in Tat expressing cells, was initially discovered as a G-protein coupled neuropeptide Y receptor, and later found to be homologous to the co-receptor CCR5 needed for HIV-1 infection of monocyte/macrophage cells.
Loading...