Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
The malonyl CoA generated in the ACC reaction then inhibits FA oxidation by reversibly inhibiting Cpt1.
Other examples of consistency between our microarray results on receptors and the HIV-1 Tat literature, include the down-regulation of gene expression in uPAR (Acc# X74039), IP3 (Acc# D26070, D26351), Glu R flop (Acc# U10302), PPAR (Acc# L07592), alpha-2 macroglobulin receptor protein (Acc# M63959), and receptor tyrosine kinase (Acc# L36645, U66406) genes.
Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.
ACC acetyl CoA carboxylase
Loading...