Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The primers for rat TNF-α, were designed using the DNASTAR Lasergene software (Madison, WI) and the rat TNF-α cDNA sequence (GenBank accession number NM 012675), and are sense (bp 127 - 150):5'-GGG GCC ACC ACG CTC TTC TGT CTA-3' and antisense (bp 285 - 307): 5'-CCT CCG CTT GGT TTG CTA CG-3', and generate a 181 bp cDNA product.
Another example of co-receptors with multiple functions is the leukotriene family member B4, which was down-regulated in Tat expressing cells (Acc# D89078, Table 1).
Other examples of consistency between our microarray results on receptors and the HIV-1 Tat literature, include the down-regulation of gene expression in uPAR (Acc# X74039), IP3 (Acc# D26070, D26351), Glu R flop (Acc# U10302), PPAR (Acc# L07592), alpha-2 macroglobulin receptor protein (Acc# M63959), and receptor tyrosine kinase (Acc# L36645, U66406) genes.
The Tnfrh1 cDNA probes (the longer probe made using primers 1 and 2, and matching the first 506 nt of Genbank Acc.
The introns were PCR-amplified with KM37 (GAT AAT ACG ACT CAC TAT AAT GGC ATT ACC GCC TTG T) and GM24 (GCT CTA GAC TTA GCT ACA ATA TGA AC) in 25 μl reactions under the conditions stated above and cycled 20 times.