Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
In the cytoplasm, FA synthesis is controlled via Acly, acetyl CoA carboxylase (ACC), and Fasn.
The primers were based on RSV ( Acc# M74568) and actin (X00351) sequences, and are as follows (sense and antisense, respectively):
Although ACC was not regulated at the transcriptional level, cytoplasmic citrate (generated from the Acly reaction) is an allosteric activator of ACC, so less cytoplasmic citrate would lead to less activation of ACC [ 45 ] . Transcript levels of hepatic acetyl CoA synthetase 1 AMP forming (acetate:CoA ligase AMP forming; Acas1) were consistently down regulated by LC-PUFA (-2.
Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.
The AtMAF1 open reading frame was isolated by PCR from Arabidopis genomic DNA using the 5' primer 5'-TCC ATG GCC GAA ACC GAA-3' and the 3' primer 5'-CTA AGT TCA CTT CGA ACT GCT C-3', which had been designed to match the Arabidopsis MAF1 homolog on the P1 clone MGG4 of chromosome 5 (GenBank accession number AB008267).
Loading...