Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
Strain K84 biological control is primarily due to production of two plasmid-encoded antibiotics, agrocins 84 and 484, encoded by genes on pAgK84 and pAgK434 respectively [ 5 ] . Agrocin 84, an adenosine analog [ 6 ] , is effective against tumorigenic strains carrying nopaline/agrocinopine tumor-inducing plasmids, and requires the acc system in the target strain for activity [ 7 ] . Agrocin 434, a di-substituted cytidine analog, is effective against, and specific for, a broad range of A. rhizogenes strains [ 8 ] . Curing of either agrocin-encoding plasmid results in reduction of biological control activity [ 9 ] . Thus, K84 demonstrates the efficacy of antibiosis for crown gall biological control.
The primers were based on RSV ( Acc# M74568) and actin (X00351) sequences, and are as follows (sense and antisense, respectively):
As described above, Acly expression (and possibly ACC activity) was significantly down regulated by LC-PUFAs, likely leading to less FA synthesis.
Using Search Launcher available on the Molecular Biology Computational Resources (MBCR) server at Baylor College of Medicine (BCM) www.mbcr.bcm.tmc.eduhomology searches on the new cDNA sequence against DBEST database identified several ESTs, {Acc.
AC013252) and BAC 126h7 (Acc.