Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
For instance, mRNA for the neuropeptide Y-like receptor (Acc# X71635), which was up-regulated in Tat expressing cells, was initially discovered as a G-protein coupled neuropeptide Y receptor, and later found to be homologous to the co-receptor CCR5 needed for HIV-1 infection of monocyte/macrophage cells.
Homologous sequences were identified on BAC 651 c23 (Acc.
Using Search Launcher available on the Molecular Biology Computational Resources (MBCR) server at Baylor College of Medicine (BCM) www.mbcr.bcm.tmc.eduhomology searches on the new cDNA sequence against DBEST database identified several ESTs, {Acc.
Another example of co-receptors with multiple functions is the leukotriene family member B4, which was down-regulated in Tat expressing cells (Acc# D89078, Table 1).
Here, we describe the effect of coactivator proteins SRC-1 (Acc# AJ000882, U90661, Table 1) and p300 (Acc# U01877, Table 3), and their relation to differentiation genes such as retinoic acid receptor (RAR/PML, Acc#: X06614, Table 1), and Leptin receptor variant (Acc#: U66496, Table 1); all of which are down-regulated in Tat expressing cells (Figure 5).