Words similar to acc
- acanthus
- acap
- acapulco
- acarbon
- acarbose
- acas
- acatccaaacagaacgtgcc-
- acatcher
- acatggactgaggagtag
- acatgggacgtaacagatac
- acatgtccagcatcaaagcgg
- acatn
- acaule
- acauses
- academy
- acc
- accaccgtggacaccttctdtdt
- accademia
- accadian
- accaggacgatcaactgggcttc
- accagtcgactctacagtgc-
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- accede
- acceded
- acceding
- accelerate
- accelerated
- acci
- accnu
Example sentences for: acc
How can you use “acc” in a sentence? Here are some example sentences to help you improve your vocabulary:
ACC acetyl CoA carboxylase
The primers were based on RSV ( Acc# M74568) and actin (X00351) sequences, and are as follows (sense and antisense, respectively):
The primers for rat TNF-α, were designed using the DNASTAR Lasergene software (Madison, WI) and the rat TNF-α cDNA sequence (GenBank accession number NM 012675), and are sense (bp 127 - 150):5'-GGG GCC ACC ACG CTC TTC TGT CTA-3' and antisense (bp 285 - 307): 5'-CCT CCG CTT GGT TTG CTA CG-3', and generate a 181 bp cDNA product.
Although ACC was not regulated at the transcriptional level, cytoplasmic citrate (generated from the Acly reaction) is an allosteric activator of ACC, so less cytoplasmic citrate would lead to less activation of ACC [ 45 ] . Transcript levels of hepatic acetyl CoA synthetase 1 AMP forming (acetate:CoA ligase AMP forming; Acas1) were consistently down regulated by LC-PUFA (-2.
Another example of co-receptors with multiple functions is the leukotriene family member B4, which was down-regulated in Tat expressing cells (Acc# D89078, Table 1).
Loading...