Words similar to aattctggagcttctggatccaagaatggaatcaaagttaag

Example sentences for: aattctggagcttctggatccaagaatggaatcaaagttaag

How can you use “aattctggagcttctggatccaagaatggaatcaaagttaag” in a sentence? Here are some example sentences to help you improve your vocabulary:

The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.