Example sentences for: aattaaaccatccaatgaaatagagc

How can you use “aattaaaccatccaatgaaatagagc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The genomic DNA fragment flanking the A54T polymorphism was amplified using two primers flanking exon 2 of the FABP2 gene: CTACCGAGTTTTCTTCCCACC and AATTAAACCATCCAATGAAATAGAGC.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast