Words similar to a-atp

Example sentences for: a-atp

How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:

The A-ATPase and the V-ATPase inteins are located in the most conserved part of the host gene.
The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).
Autocatalytic splicing of the T. acidophilum A-ATPase catalytic subunit occurs efficiently in the E. coli cytoplasm.
The T. acidophilum A-ATPase intein appears to splice out efficiently at very different pHs (7.
Apparently, the small intein has been persisting in the Thermoplasma A-ATPase since the split between T. acidophilum and T. volcanium without the help of a homing endonuclease.