Words similar to a-atp
Example sentences for: a-atp
How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:
The other two major differences in codon usage between the T. acidophilum A-ATPase A subunit and E. coli are AGG (Arg) and AGA (Arg) which are present in T. acidophilum A-ATPase A subunit at frequencies of 41 and 16 per 1000 respectively.
One explanation for the discrepancy between phylogenetic classification and distribution of the A-ATPase intein is horizontal gene transfer: the intein was not present in the last common ancestor of Thermoplasma and Pyrococcus, rather the intein invaded one of the lineages after their split and was more recently horizontally transferred to the other lineage.
The Pyrococcus furiosus A-ATPase sequence was retrieved via blastp from the unfinished genome using the web page http://combdna.umbi.umd.edu/bags.html.
The small intein in the Thermoplasma A-ATPase is closely related to the endonuclease containing intein in the Pyrococcus A-ATPase.
The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).