Words similar to a-atp

Example sentences for: a-atp

How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:

The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).
These primers match the coding sequence of the Thermoplasma acidophilum A-ATPase A subunit (gene identification number 9369337) and introduce restriction sites useful in subcloning.
The cyclic reinvasion model for long term persistence of a selfish genetic element through homing [ 38 ] suggests that the small Thermoplasma intein evolved through reduction from a large endonuclease containing intein similar to the one found in the pyrococcal A-ATPase.
The Pyrococcus furiosus A-ATPase sequence was retrieved via blastp from the unfinished genome using the web page http://combdna.umbi.umd.edu/bags.html.
Multiple sequence alignments of diverse intein sequences identified eight motifs composed of moderately conserved residues [ 18 28 ] . The A-ATPase A subunit of the Thermoplasma and Pyrococcus intein multiple sequence alignment (with manual modification) is shown in figure 1. The T. acidophilum intein (173 amino acids long) is among the shortest inteins known, and the alignment with other inteins reveals the absence of sequences homologous to the typical endonuclease motifs.