Words similar to a-atp
Example sentences for: a-atp
How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:
Here we present data on the cloning and expression of the T. acidophilum A-ATPase A subunit in E. coli, and we discuss implications for the location, propagation and distribution of inteins among organisms.
The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).
Autocatalytic splicing of the T. acidophilum A-ATPase catalytic subunit occurs efficiently in the E. coli cytoplasm.
The T. acidophilum A-ATPase intein appears to splice out efficiently at very different pHs (7.
One explanation for the discrepancy between phylogenetic classification and distribution of the A-ATPase intein is horizontal gene transfer: the intein was not present in the last common ancestor of Thermoplasma and Pyrococcus, rather the intein invaded one of the lineages after their split and was more recently horizontally transferred to the other lineage.
Loading...