Words similar to a-atp

Example sentences for: a-atp

How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:

One explanation for the discrepancy between phylogenetic classification and distribution of the A-ATPase intein is horizontal gene transfer: the intein was not present in the last common ancestor of Thermoplasma and Pyrococcus, rather the intein invaded one of the lineages after their split and was more recently horizontally transferred to the other lineage.
Here we present data on the cloning and expression of the T. acidophilum A-ATPase A subunit in E. coli, and we discuss implications for the location, propagation and distribution of inteins among organisms.
The small intein in the Thermoplasma A-ATPase is closely related to the endonuclease containing intein in the Pyrococcus A-ATPase.
The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).
The Pyrococcus furiosus A-ATPase sequence was retrieved via blastp from the unfinished genome using the web page http://combdna.umbi.umd.edu/bags.html.