Words similar to a-atp

Example sentences for: a-atp

How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:

The T. acidophilum A-ATPase A subunit has 763 codons.
The gene encoding the T. acidophilum A-ATPase A subunit was cloned into the expression vector pET-11a (Stratagene) and transformed into E. coli Bl21(DE3) and E. coli Bl21-CodonPlus(DE3)-RIL strain for protein expression.
The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).
Comparison of A-ATPase catalytic subunit and 16S rRNA phylogeny
The small intein in the Thermoplasma A-ATPase is closely related to the endonuclease containing intein in the Pyrococcus A-ATPase.