Example sentences for: a-atp

How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).

  • The T. acidophilum A-ATPase A subunit has 763 codons.

  • Apparently, the small intein has been persisting in the Thermoplasma A-ATPase since the split between T. acidophilum and T. volcanium without the help of a homing endonuclease.

  • The structure of the bovine mitochondrial F 1 -ATPase has been determined by X-ray crystallography [ 30 ] . The intein insertion points in the yeasts' V-ATPase and the Thermoplasma and Pyrococcus A-ATPases correspond to the catalytic site where the ATP binds and is hydrolyzed during the catalytic cycle.

  • Either the whole A-ATPase catalytic subunits was transferred, or the intein alone spread as a selfish genetic element.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast