Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
, overweight: 25 kg/m 2< BMI < 30 kg/m 2; obese: BMI ≥ 30 kg/m 2) and an age- and gender-weighted chronic disease score (CDS) [ 15 ] based on the presence or absence of 29 specific comorbidities determined from pharmacy dispensing data.
There are, however, several published microarray experiments in which, although individual variation in gene expression was not explicitly addressed, variation in gene expression in age- and sex-matched individual mice or pooled samples of three or fewer mice was measured and found to be relatively small [ 36 37 38 39 ] . These include data from both peripheral tissue and brain that reported r -values for individual mice at around 0.98 [ 37 38 ] , and one publicly available dataset of inter-individual comparisons of CNS tissues [ 38 ] . We analyzed this dataset and found it to have correlation coefficients in the 0.97-0.
While many studies have examined expression in inbred mice, the extent of variation in gene expression in age- and sex-matched individuals is rarely addressed.
[ 5, 14, 15] Age- and sex-standardized and stratified incidence rates of total stroke were also estimated.
Kleinfeld and coworkers [ 27 ] demonstrated that elderly women were more vulnerable to hypokalemia, and indicated that this was possibly due to age- and sex-associated differences in body mass composition, which might result in a physiologically low total exchangeable body potassium.