Words similar to agctggccctggcactgctctgctct

Example sentences for: agctggccctggcactgctctgctct

How can you use “agctggccctggcactgctctgctct” in a sentence? Here are some example sentences to help you improve your vocabulary:

The genomic DNA fragment flanking the Fok I polymorphism was amplified using two primers flanking exon 2 of the VDR gene: AGCTGGCCCTGGCACTGCTCTGCTCT and ATGGAAACACCTTGCTTCTTCTCCCTC.