Example sentences for: ypd

How can you use “ypd” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • We chose three representative environmental conditions: amino-acid starvation (30 min) [ 30 ] ; stationary phase (10 h in YPD) [ 30 ] ; and ergosterol inhibition (terbinafine) [ 35 ] . We constructed regression models using counts of individual words in S. cerevisiae TCRs, or using counts of words that were conserved among Saccharomyces TCRs.

  • A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.

  • As shown in Figure 1, tetrads produced four viable colonies, two of which were large and white, and two of which were smaller and pink on YPD medium, which scored as ade- on SDC -ade medium.

  • While NetSearch correctly identified the upstream elements of this pathway (Sln1p → Ypd1p → Ssk1p → Ssk22p), it was unable to form any connections to Pbs2p or Hog1p that ended in a transcription factor.

  • All yeast strains used in this study are listed in Table 1. General yeast manipulations were conducted by standard methods [ 62 ] with transformations by the lithium acetate method [ 63 ] . All strains were grown at 23° in YPD (yeast extract, peptone, 2% glucose) unless otherwise noted.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast