Words similar to ypd
Example sentences for: ypd
How can you use “ypd” in a sentence? Here are some example sentences to help you improve your vocabulary:
To screen for GFP-Nup localization, temperature sensitive strains were inoculated individually in 2 ml liquid YPD cultures and grown at 23° for 12-16 hours before shifting to 34° for 4-6 hours.
Mutants were grown at 23° overnight in 5 ml YPD to logarithmic phase.
The same crosses were also used to determine if Tab +was recessive or dominant: for every tab mutant, haploid cdc15Δ tab [pMET3-cdcl5-2, URA3] and diploid cdc15Δ/cdc15Δ tab/+ [pMET3-cdc15-2, URA3 ] cells were pre-grown on YPD (1% yeast extract/2% peptone + 2% glucose) at 25°C for 2-3 days, spotted in 5-fold serial dilutions onto SD+5-FOA plates, and the number of 5-FOA resistant colonies from the diploid was divided by that from the haploid to obtain ratio P. The mutant was defined to be dominant if P= 0.1-1, semi-dominant if P= 0.01-0.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
We chose three representative environmental conditions: amino-acid starvation (30 min) [ 30 ] ; stationary phase (10 h in YPD) [ 30 ] ; and ergosterol inhibition (terbinafine) [ 35 ] . We constructed regression models using counts of individual words in S. cerevisiae TCRs, or using counts of words that were conserved among Saccharomyces TCRs.
Loading...