Example sentences for: ypd

How can you use “ypd” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • A total of 54 single colonies derived from the 16 heterozygotes were inoculated into separate YPD liquid cultures.

  • Every protein NetSearch included in this network model has a description in the Yeast Proteome Database (YPD) [ 9 ] consistent with a known or plausible role in mating.

  • A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.

  • When cells were pre-grown in YPD liquid (instead of SD-URA solid) media before being tested on YPD plates, the percentage of colonies that were red or had red sectors remained similar for wild-type, CDC14 TAB 6-1 , and bub2Δ strains, but was ~25% for net1 tab 2-1.

  • While NetSearch correctly identified the upstream elements of this pathway (Sln1p → Ypd1p → Ssk1p → Ssk22p), it was unable to form any connections to Pbs2p or Hog1p that ended in a transcription factor.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast